<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "journalpublishing3.dtd">
<article article-type="research-article" dtd-version="3.0" xml:lang="en" xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink">
	<front>
		<journal-meta>
			<journal-id journal-id-type="publisher-id">GYA</journal-id>
			<journal-title-group>
				<journal-title>Grasas y Aceites</journal-title>
			</journal-title-group>
			<issn pub-type="epub">0017-3495</issn>
			<publisher>
				<publisher-name>Consejo Superior de Investigaciones Cientificas</publisher-name>
			</publisher>
		</journal-meta>
		<article-meta>
			<article-id pub-id-type="publisher-id">GYA201394_e093-1190142</article-id>
			<article-id pub-id-type="doi">10.3989/gya.1190142</article-id>
			<article-categories>
				<subj-group subj-group-type="heading">
					<subject>Articles</subject>
				</subj-group>
			</article-categories>
			<title-group>
				<article-title>Isolation and expression analysis of glycerol-3-phosphate acyltransferase genes from peanuts (<italic>Arachis hypogaea</italic> L.)</article-title>
				<trans-title-group xml:lang="es">
					<trans-title>Aislamiento y an&#x00E1;lisis de la expresi&#x00F3;n del gen aciltransferasa glicerol-3-fosfato de cacahuete (<italic>Arachis hypogaea L</italic>.)</trans-title>
				</trans-title-group>
				<alt-title alt-title-type="running-head">Isolation and expression analysis of glycerol-3-phosphate acyltransferase genes from peanuts (<italic>Arachis hypogaea</italic> L.)</alt-title>
			</title-group>
			<contrib-group>
				<contrib contrib-type="author">
					<name>
						<surname>Chi</surname>
						<given-names>X.</given-names>
					</name>
					<xref ref-type="aff" rid="AF0001">a</xref>
					<xref ref-type="aff" rid="AF0002">b</xref>
				</contrib>
				<contrib contrib-type="author">
					<name>
						<surname>Yang</surname>
						<given-names>Q.</given-names>
					</name>
					<xref ref-type="aff" rid="AF0003">c</xref>
				</contrib>
				<contrib contrib-type="author">
					<name>
						<surname>Pan</surname>
						<given-names>L.</given-names>
					</name>
					<xref ref-type="aff" rid="AF0002">b</xref>
				</contrib>
				<contrib contrib-type="author">
					<name>
						<surname>Chen</surname>
						<given-names>N.</given-names>
					</name>
					<xref ref-type="aff" rid="AF0002">b</xref>
				</contrib>
				<contrib contrib-type="author">
					<name>
						<surname>Chen</surname>
						<given-names>M.</given-names>
					</name>
					<xref ref-type="aff" rid="AF0002">b</xref>
				</contrib>
				<contrib contrib-type="author">
					<name>
						<surname>Wang</surname>
						<given-names>T.</given-names>
					</name>
					<xref ref-type="aff" rid="AF0002">b</xref>
				</contrib>
				<contrib contrib-type="author">
					<name>
						<surname>Wang</surname>
						<given-names>M.</given-names>
					</name>
					<xref ref-type="aff" rid="AF0002">b</xref>
				</contrib>
				<contrib contrib-type="author">
					<name>
						<surname>Yang</surname>
						<given-names>Z.</given-names>
					</name>
					<xref ref-type="aff" rid="AF0002">b</xref>
				</contrib>
				<contrib contrib-type="author" corresp="yes">
					<name>
						<surname>Guan</surname>
						<given-names>X.</given-names>
					</name>
					<xref ref-type="aff" rid="AF0004">d</xref>
					<xref ref-type="corresp" rid="cor1">&#x002A;</xref>
				</contrib>
				<contrib contrib-type="author" corresp="yes">
					<name>
						<surname>Yu</surname>
						<given-names>S.</given-names>
					</name>
					<xref ref-type="aff" rid="AF0002">b</xref>
					<xref ref-type="corresp" rid="cor1">&#x002A;</xref>
				</contrib>
			</contrib-group>
			<aff id="AF0001">
				<label>a</label>Key Laboratory of Biology and Genetic Improvement of Oil Crops, Ministry of Agriculture, Oil Crops Research Institute, Chinese Academy of Agricultural Sciences, Wuhan, 430062, P. R. China</aff>
			<aff id="AF0002">
				<label>b</label>Shandong Peanut Research Institute, Qingdao, 266100, P R China</aff>
			<aff id="AF0003">
				<label>c</label>College of food science and engineering of Qingdao agricultural university, Qingdao, 266109, P R China</aff>
			<aff id="AF0004">
				<label>d</label>School of Ocean Sciences, China University of Geosciences, Beijing 100083, P R China</aff>
			<author-notes>
				<corresp id="cor1"><label>&#x002A;</label>Corresponding authors: <email xlink:href="shanlinyu2012@163.com">shanlinyu2012@163.com</email>; <email xlink:href="guanxy@cugb.edu.cn">guanxy@cugb.edu.cn</email>
				</corresp>
			</author-notes>
			<pub-date pub-type="epub">
				<day>30</day>
				<month>09</month>
				<year>2015</year>
			</pub-date>
			<pub-date pub-type="collection">
				<year>2015</year>
			</pub-date>
			<volume>66</volume>
			<issue>3</issue>
			<elocation-id content-type="doi">10.3989/gya.1190142</elocation-id>
			<history>
				<date date-type="received">
					<day>24</day>
					<month>11</month>
					<year>2014</year>
				</date>
				<date date-type="accepted">
					<day>10</day>
					<month>03</month>
					<year>2015</year>
				</date>
			</history>
			<permissions>
				<copyright-statement>&#x00A9; 2015 CSIC</copyright-statement>
				<copyright-year>2015</copyright-year>
				<license license-type="open-access" xlink:href="http://creativecommons.org/licenses/by-nc/3.0/">
					<license-p>This is an open-access article distributed under the terms of the Creative Commons Attribution-Non Commercial (by-nc) Spain 3.0 License.</license-p>
				</license>
			</permissions>
			<abstract>
				<title>SUMMARY</title>
				<p><italic>sn</italic>-Glycerol-3-phosphate acyltransferase (GPAT) catalyzes the committed step in the production of glycerolipids. The functions of GPAT genes have been intensively studied in Arabidopsis, but not in peanuts (<italic>Arachis hypogaea</italic> L.). In this study, six <italic>AhGPAT</italic> genes were isolated from peanuts. Quantitative real-time RT-PCR analysis indicated that the <italic>AhGPAT9</italic> transcript was more abundant in the stems, flowers, and seeds, whereas the transcript abundances of five other genes were higher in the leaves or flowers than in the other tissues examined. During seed development, the transcript levels of <italic>AhGPAT9</italic> gradually increased, whereas the transcript levels of the other five genes decreased. In addition, the levels of <italic>AhGPAT2</italic> transcript were distinctly enhanced after exposure to all four kinds of stress treatments except for ABA-treated leaves. The transcripts of <italic>AhGPAT1</italic>, <italic>AhGPAT6</italic>, <italic>AhGPAT8</italic> and <italic>AhATS1</italic> increased substantially in roots exposed to salt, drought, and ABA stress. The expressions of <italic>AhGPAT6</italic>, <italic>AhGPAT8</italic>, <italic>AhGPAT</italic>9 and <italic>AhATS1</italic> were slightly higher in leaves under certain stress conditions than under normal conditions. The present study provides significant information for modifying oil deposition and improving the abiotic stress resistance of peanuts through molecular breeding.</p>
				</abstract>
				<trans-abstract xml:lang="es">
				<title>RESUMEN</title>
				<p><bold><italic>Aislamiento y an&#x00E1;lisis de la expresi&#x00F3;n del gen aciltransferasa glicerol-3-fosfato de cacahuete</italic> (Arachis hypogaea <italic>L</italic>.)</bold>. La aciltransferasa <italic>sn</italic>-glicerol-3-fosfato (ATGP) cataliza el comprometido paso de la producci&#x00F3;n de glicerol&#x00ED;pidos. Las funciones de los genes <italic>AhATGP</italic> se han estudiado intensivamente en Arabidopsis, pero no en cacahuete (<italic>Arachis hypogaea</italic> L.). En este estudio, seis genes <italic>AhATGP</italic> se aislaron a partir de cacahuetes. El an&#x00E1;lisis a tiempo real RT-PCR cuantitativa indic&#x00F3; que la transcripci&#x00F3;n <italic>AhATGP9</italic> fue m&#x00E1;s abundante en tallos, flores y semillas, mientras que la abundancia de la transcripci&#x00F3;n de los otros cinco genes fueron mayores en hojas o flores que en los otros tejidos examinados. Durante el desarrollo de la semilla, los niveles de transcripci&#x00F3;n de <italic>AhATGP9</italic> aumentaron gradualmente, mientras que los niveles de transcripci&#x00F3;n de otros cinco genes disminuyeron. Adem&#x00E1;s, los niveles de transcripci&#x00F3;n <italic>AhATGP2</italic> mejoraron claramente despu&#x00E9;s de la exposici&#x00F3;n a los cuatro tipos de tratamientos de estr&#x00E9;s excepto para las hojas tratadas con ABA. Las transcripciones de <italic>ATGP1</italic>, <italic>ATGP6</italic>, <italic>ATGP8</italic> y <italic>AhATS1</italic> aumentaron considerablemente en las ra&#x00ED;ces expuestas a sal, sequ&#x00ED;a y estr&#x00E9;s de ABA. Las expresiones de <italic>AhGPAT6</italic>, <italic>AhGPAT8</italic>, AhGPAT9 y <italic>AhATS1</italic> fueron ligeramente m&#x00E1;s altos en las hojas bajo ciertas condiciones de estr&#x00E9;s que en condiciones normales. El presente estudio proporciona informaci&#x00F3;n importante para utilizar en la modificaci&#x00F3;n de la acumulaci&#x00F3;n de aceite y mejorar la resistencia al estr&#x00E9;s abi&#x00F3;tico de man&#x00ED; a trav&#x00E9;s de mejoramiento molecular.</p>
				</trans-abstract>
			<kwd-group xml:lang="en">
			<title>KEYWORDS</title>
				<kwd>Glycerol-3-phosphate acyltransferase</kwd>
				<kwd>Peanuts (<italic>Arachis hypogaea</italic> L.)</kwd>
				<kwd>Phylogenetic analysis</kwd>
				<kwd>Quantitative real-time RT-PCR</kwd>
				</kwd-group>
				<kwd-group xml:lang="es">
				<title>PALABRAS CLAVE</title>
				<kwd>Aciltransferasa glicerol-3-fosfato</kwd>
				<kwd>An&#x00E1;lisis filogen&#x00E9;tico</kwd>
				<kwd>Cacahuete (<italic>Arachis hypogaea</italic> L.)</kwd>
				<kwd>PCR cuantitativa a tiempo real (RT-PCR)</kwd>
			</kwd-group>
		</article-meta>
	</front>
	<body>
		<sec id="S0001" sec-type="intro">
			<title>1. INTRODUCTION</title>
			<p>Plant lipids are composed of a wide variety of fatty acids and their derivatives, including glycerolipids, lipid polyesters, and sterols. Plant lipids are involved in a diverse range of metabolic reactions and play important physiological roles in plant development, such as major components of cellular membranes, storage reserves, extracellular protective layers, and signaling molecules (Chen <italic>et al</italic>., <xref ref-type="bibr" rid="CIT0005">2011a</xref>). The biosynthesis of these different types of lipids is controlled by a complex network of genes and proteins. <italic>sn-</italic>Glycerol-3-phosphate acyltransferases (GPAT) is the first enzyme in the pathway for the <italic>de novo</italic> synthesis of glycerolipids and is involved in different metabolic pathways and physiological processes (Yang <italic>et al</italic>., <xref ref-type="bibr" rid="CIT0029">2012</xref>). It catalyzes the transfer of an acyl group from acyl-coenzyme A (CoA) or acyl-acyl carrier protein (ACP) to the <italic>sn-</italic>1 position of <italic>sn</italic>-glycerol-3-phosphate (G3P). Plants contain three types of GPATs, which are located in plastids, mitochondria, and cytoplasm, respectively (Xu <italic>et al</italic>., <xref ref-type="bibr" rid="CIT0027">2006</xref>; Li <italic>et al</italic>., <xref ref-type="bibr" rid="CIT0013">2011</xref>). The enzyme in plastids is soluble and uses acyl-ACP as the acyl donor, whereas the enzymes in the mitochondria and the cytoplasm are bound to membranes and use acyl-CoA as the acyl donor (Murata and Tasaka, <xref ref-type="bibr" rid="CIT0019">1997</xref>).</p>
			<p>In Arabidopsis, 10 genes have been identified as encoding GPAT enzymes located in various subcellular compartments, such as plastids (<italic>AtATS1</italic>), mitochondria (<italic>AtGPAT1</italic>), and the endoplasmic reticulum (ER; <italic>AtGPAT8</italic> and <italic>AtGPAT9</italic>) (Xu <italic>et al</italic>., <xref ref-type="bibr" rid="CIT0027">2006</xref>; Zheng <italic>et al</italic>., <xref ref-type="bibr" rid="CIT0030">2003</xref>; Gidda <italic>et al</italic>., <xref ref-type="bibr" rid="CIT0009">2009</xref>). The soluble, plastid-localized ATS1 (At1g32200) uses acyl-ACP substrates and exhibits <italic>sn</italic>-1 acyl transfer regio-specifically (Nishida <italic>et al</italic>., <xref ref-type="bibr" rid="CIT0020">1993</xref>). A second enzyme, GPAT9 (At5g60620), is not related to GPAT1&#x2013;GPAT8 but is most homologous to the mammalian GPAT3, which is directly involved in the synthesis of triacylglycerols in the adipose tissues (Cao <italic>et al</italic>., <xref ref-type="bibr" rid="CIT0004">2006</xref>). GPAT9 protein is localized to the ER (Gidda <italic>et al</italic>., <xref ref-type="bibr" rid="CIT0009">2009</xref>) and may be an acyl-CoA-dependent <italic>sn</italic>-1 GPAT that enables non-plastid glycerolipid synthesis. The remaining eight GPATs cluster together in a family (Zheng <italic>et al</italic>., <xref ref-type="bibr" rid="CIT0030">2003</xref>; Gidda <italic>et al</italic>., <xref ref-type="bibr" rid="CIT0009">2009</xref>; Beisson <italic>et al</italic>., <xref ref-type="bibr" rid="CIT0002">2007</xref>) which is not required for membrane or storage lipid biosynthesis. Instead, several members of the family clearly affect the composition and quantity of cutin or suberin. They transfer acyl groups to the <italic>sn</italic>-2 position with three distinct clades which are associated with key stages in the morphological and functional evolution of land plants and also coincide with a loss in phosphatase activity (Yang <italic>et al</italic>., <xref ref-type="bibr" rid="CIT0029">2012</xref>). Within the cutin-associated clade, GPAT4, GPAT6, and GPAT8 have been shown to behave as bifunctional <italic>sn</italic>-2 acyltransferase/phosphatase enzymes capable of generating 2-monoacylglycerol (MAG) products. They strongly prefer C16:0 and C18:1 &#x3C9;-oxidized acyl-CoAs over unmodified or longer acyl chain substrates (Yang <italic>et al</italic>., <xref ref-type="bibr" rid="CIT0029">2012</xref>). In contrast, suberin-associated GPAT5 and GPAT7 possess <italic>sn-</italic>2 acyltransferase but not phosphatase activity, and can accommodate a broad chain-length range of &#x3C9;-oxidized and unsubstituted acyl-CoAs. The enzymes GPAT1&#x2013;GPAT3 represent a distinct clade from the GPAT4/6/8 and the GPAT5/7 clades in the GPAT family of Arabidopsis. Within this clade, phosphatase-minus GPAT1 can use dicarboxylic acyl-CoA substrates, whereas the same activity could not be detected for GPAT2 and GPAT3. Even though GPAT2 and GPAT3 have lost their key amino acids in their phosphatase domain, they retain their HXXXXD and CPEGT conserved acyl transferase domain motifs, and may thus be expected to function as active acyltransferases (Yang <italic>et al</italic>., <xref ref-type="bibr" rid="CIT0029">2012</xref>).</p>
			<p>In Arabidopsis, <italic>AtGPAT1</italic> encodes a mitochondrial isozyme that is necessary for pollen development, although <italic>AtGPAT1</italic> deficiency does not affect the levels of seed oil (Zheng <italic>et al</italic>., <xref ref-type="bibr" rid="CIT0030">2003</xref>). Analysis of loss-of-function mutants in Arabidopsis demonstrated an essential role of <italic>AtGPAT5</italic> for suberin biosynthesis in the root and seed coat (Beisson <italic>et al</italic>., <xref ref-type="bibr" rid="CIT0002">2007</xref>). Monomer composition analysis and overexpression of <italic>AtGPAT5</italic> in Arabidopsis and tobacco plants caused secretion of MAGs onto the surface of leaves (Li <italic>et al</italic>., <xref ref-type="bibr" rid="CIT0015">2007a</xref>). Similarly, <italic>AtGPAT4</italic> and <italic>AtGPAT8</italic> likely encode redundant activities necessary for the assembly of cutin monomers in the stems and leaves (Li <italic>et al</italic>., <xref ref-type="bibr" rid="CIT0014">2007b</xref>), whereas <italic>AtGPAT6</italic> is involved in cutin assembly in sepals and petals (Li-Beisson <italic>et al</italic>., <xref ref-type="bibr" rid="CIT0016">2009</xref>). In <italic>Brassica napus</italic>, three homologous <italic>GPAT4</italic> genes exhibited different expression patterns and distinct epigenetic features. A phenotypic rescue of a <italic>gpat4 gpat8 Arabidopsis</italic> double mutant and analysis of the <italic>gpat4</italic> RNAi lines of <italic>B. napus</italic> suggested physiological roles of <italic>GPAT4s</italic> in cuticle formation of the rosette leaves, early flower development, pollen development, and the biosynthesis of storage lipids (Chen <italic>et al</italic>., <xref ref-type="bibr" rid="CIT0006">2011b</xref>). Two homologous <italic>GPAT</italic> genes isolated from <italic>Echium pitardii</italic> have high similarity to the <italic>AtGPAT4</italic>/<italic>8</italic> genes of Arabidopsis. Whereas the transcripts of <italic>EpGPAT1</italic> were most abundant in seeds, roots, young leaves, and flowers, the transcripts of <italic>EpGPAT2</italic> were most abundant in developing leaves and flowers. The ectopic expression of <italic>EpGPAT1</italic> in the leaves of tobacco plants increased the levels of C16 and C18 hydroxyacids and a,&#x3C9;-diacids in the cell wall fraction, indicating a role for <italic>EpGPAT1</italic> in the biosynthesis of cutin polyesters (Ma&#x00F1;as-Fern&#x00E1;ndez <italic>et al</italic>., <xref ref-type="bibr" rid="CIT0017">2010</xref>).</p>
			<p>
				<italic>In vivo</italic> experiments showed that the overexpression of Arabidopsis <italic>AtAST1</italic> in tobacco increased both the degree of unsaturation of fatty acids in phosphatidylglycerol (PG) and the resistance of tobacco to chilling stress (Murata <italic>et al</italic>., <xref ref-type="bibr" rid="CIT0018">1992</xref>). An increase in the level of unsaturation of fatty acids in PG from rice plants transformed with an <italic>AtATS1</italic> cDNA improved photosynthetic rates and growth at low temperatures (Ariizumi <italic>et al</italic>., <xref ref-type="bibr" rid="CIT0001">2002</xref>). The overexpression of <italic>LeATS1</italic> increased the levels of PG <italic>cis</italic>-unsaturated fatty acids in the thylakoid membranes of tomato, which promoted recovery from chilling-induced photoinhibition of photosystem I (PSI) (Sui <italic>et al</italic>., <xref ref-type="bibr" rid="CIT0023">2007</xref>). The increase in saturation of thylakoid membrane lipids in transgenic tobacco with expressed <italic>ATS1</italic> from sweet pepper enhanced the thermotolerance of the photosynthetic apparatus of transgenic tobacco (Yan <italic>et al</italic>., <xref ref-type="bibr" rid="CIT0028">2008</xref>).</p>
			<p>Given that the members of the GPAT family have several complicated roles during plant development and acclimation to stressful conditions, functional analyses of each member of the gene family should be helpful in elucidating the roles of GPAT isoforms. The peanut (<italic>Arachis hypogaea</italic> L.) is an allotetraploid species (2n=4&#x00D7;=40, AABB) and one of the five most important oilseed crops worldwide. It is grown extensively in tropical, subtropical, and temperate climates. The peanut seed comprises around 50% oil, of which approximately 80% consists of oleic (36&#x2013;67%) and linoleic (15&#x2013;43%) acids (Chi <italic>et al</italic>., <xref ref-type="bibr" rid="CIT0008">2011</xref>). Several molecular studies of lipid biosynthesis in peanuts have been reported in recent years. However, there have been no reports about the function of the GPAT family proteins in peanuts. In the present study, we isolated six novel <italic>GPAT</italic> genes from peanuts. The expression patterns of these genes were investigated in different tissues and at different stages of seed development. Expressions of these genes were also analyzed under conditions of cold, salt, drought, and ABA stress. Our findings should be of value in efforts to modify lipid biosynthesis in peanut seeds and to provide a theoretical basis for the study of abiotic stress tolerance in peanut.</p>
		</sec>
		<sec id="S0002" sec-type="material|methods">
			<title>2. MATERIALS AND METHODS</title>
			<sec id="S20003">
				<title>2.1. Plant materials</title>
				<p>Peanut plants (<italic>A. hypogaea</italic> L. cultivar Huayu 19) were grown in a growth chamber with a 16 h light/8 h dark photoperiod at 26 &#x00B0;C/22 &#x00B0;C day/night temperatures. Leaves, stems, cotyledons, hypocotyls, and roots were sampled from the seedlings at the trefoil leaf stage. Seeds were sampled at 10, 20, 30, 40, 50, and 60 days after pegging (DAP). Flowers were collected when the seedlings were in the flowering phase. For the cold treatment, seedlings in the soil at the trefoil leaf stage were kept at 4 &#x00B0;C, and leaves were sampled separately either before cold treatment (0 h) or after continuous exposure to 4 &#x00B0;C for 1, 3, 6, 12, 24, 48, or 72 h. For stress treatments, the roots of seedlings grown in soil were flushed carefully with tap water to remove all soil, and then submerged in solutions of 200 mM NaCl, 20% PEG-6000, or 100 &#x03BC;M ABA. Leaves and roots were sampled separately after treatment for 0, 1, 3, 6, 12, 24, 48, or 72 h. All samples were immediately frozen in liquid nitrogen and stored at &#x2212;80 &#x00B0;C until required.</p>
			</sec>
			<sec id="S20004">
				<title>2.2. Identification of glycerol-3-phosphate acyltransferase family genes in a peanut cDNA library using bioedit software</title>
				<p>The cDNA sequences used in this study came from three cDNA libraries from three institutes (data not shown): Shandong Peanut Research Institute, Oil Crops Research Institute of The Chinese Academy of Agricultural Sciences, and Crops Research Institute of Guangdong Academy of Agricultural Sciences. All expressed sequence tags (ESTs) of the 36,741 cDNA sequences were saved as FASTA format. The amino acid sequences of glycerol-3-phosphate acyltransferase genes of Arabidopsis, <italic>AtGPAT2</italic> (NP_563651), <italic>AtGPAT9</italic> (NP_568925) and <italic>AtATS1</italic> (NP_174499) were used to search for homogeneous genes from the peanut cDNA library. Before searching for members of the <italic>GPAT</italic> gene family, a local nucleotide database file was created using Bioedi software. A local BLAST procedure was then run to find the homologous genes of the GPAT family. Using this method, we found six genes that may encode GPAT proteins.</p>
			</sec>
			<sec id="S20005">
				<title>2.3. Total RNA isolation and cDNA synthesis</title>
				<p>The total RNA was extracted using the RNeasy Plant Mini kit (Qiagen, Valencia, CA, USA). Contamination with genomic DNA was eliminated by treatment with recombinant DNase I (Qiagen), as recommended by the vendor. Only RNA preparations having an A260/A280 ratio of 1.8&#x2013;2.0 and an A260/A230 ratio &#x003E;2.0 were used for subsequent analysis. The integrity of RNA was verified by electrophoresis through 2% agarose gels, followed by SYBR Green staining. First-strand cDNA synthesis was carried out with 2 &#x03BC;g RNA using an RT-PCR kit (Promega, WI, USA) according to the manufacturer&#x0027;s procedure.</p>
			</sec>
			<sec id="S20006">
				<title>2.4. Isolation of full-length cDNA sequences</title>
				<p>We performed PCR with the LA PCR system (TaKaRa) using 2.5 &#x03BC;L of 10&#x00D7;PCR buffer with MgCl<sub>2</sub>, 1 &#x03BC;L of each primer (10 &#x03BC;M), 4.0 &#x03BC;L of 10 mM dNTPs, 1 &#x03BC;L of cDNA sample, 0.5 &#x03BC;L of LA Taq&#x2122; DNA polymerase, and 15 &#x03BC;L of double-distilled water. The PCR products were separated by electrophoresis through a 1% agarose gel, and purified using a Gel Extraction Kit (Takara) according to the manufacturer&#x0027;s protocol. The purified products were then cloned into the pMD18-T Easy vector (Takara) and sequenced (Shangon, Shanghai).</p>
			</sec>
			<sec id="S20007">
				<title>2.5. Sequence analysis</title>
				<p>The open reading frames (ORFs) and encoded amino acid sequences of all the genes were deduced using BioXM 2.6. The physicochemical properties of the deduced protein were predicted using Protparam (<ext-link ext-link-type="uri" xlink:href="http://www.expasy.ch/tools/protparam.html">http://www.expasy.ch/tools/protparam.html</ext-link>). Active sites of the protein sequence were analyzed by comparison against the PROSITE database. Predicted transmembrane domain (TMDs) in GPAT proteins were identified using the TMHMM Server (version 2.0) (<ext-link ext-link-type="uri" xlink:href="http://www.cbs.dtu.dk/services/TMHMM">http://www.cbs.dtu.dk/services/TMHMM</ext-link>) and visual inspection. The putative subcellular localizations of the candidate proteins were estimated by TargetP (<ext-link ext-link-type="uri" xlink:href="http://www.cbs.dtu.dk/services/TargetP/">http://www.cbs.dtu.dk/services/TargetP/</ext-link>) and Predotar (<ext-link ext-link-type="uri" xlink:href="http://urgi.versailles.inra.fr/predotar/predotar.html">http://urgi.versailles.inra.fr/predotar/predotar.html</ext-link>).</p>
			</sec>
			<sec id="S20008">
				<title>2.6. Gene structure prediction and conserved motif scanning</title>
				<p>The gene structure display server (GSDS) program (Guo <italic>et al</italic>., 2007) was used to illustrate exon/intron organization for individual desaturase genes by comparison of the cDNAs with their corresponding genomic DNA sequences. To identify the conserved motifs, MEME (Multiple Expectation Maximization for Motif Elicitation) version 4.9.1 (<ext-link ext-link-type="uri" xlink:href="http://meme.nbcr.net/meme/cgi-bin/meme.cgi">http://meme.nbcr.net/meme/cgi-bin/meme.cgi</ext-link>) was employed with a set of parameters as follows: number of repetitions &#x2013; any, maximum number of motifs &#x2013;20, optimum motif width set to &#x2265;6 and &#x2264;200 (Bailey and Elkan 1995). The motifs obtained were recorded using the SMART (<ext-link ext-link-type="uri" xlink:href="http://smart.embl-heidelberg.de/">http://smart.embl-heidelberg.de/</ext-link>) and NCBI-CDD (National Center for Biotechnology Information Conserved Domain Database) search programs.</p>
			</sec>
			<sec id="S20009">
				<title>2.7. Phylogenetic analysis</title>
				<p>Homologs of each member of the <italic>Arabidopsis</italic> GPAT family were identified by BLASTP searches with datasets from Phytozome v9.1 (<ext-link ext-link-type="uri" xlink:href="http://www.phytozome.net">www.phytozome.net</ext-link>). Only those sequences with an e-value less than e<sup>&#x2212;50</sup> were considered as members of the GPAT family. In each tree, gene sequences other than Arabidopsis and peanut GPATs were displayed using the nomenclature with the following abbreviations: Ah, <italic>Arachis hypogaea</italic>; At, <italic>Arabidopsis thaliana</italic>; Glyma, <italic>Glycine max</italic>; Medtr, <italic>Medicago truncatula</italic>; Pp, <italic>Physcomitrella patens</italic>; Cre, <italic>Chlamydomonas reinhardtii</italic>; Vocar, <italic>Volvox carteri</italic>. <xref ref-type="table" rid="T0001">Table 1</xref> provides a detailed description of the proteins used and the corresponding accession numbers. Amino acid sequences were aligned using the ClustalX program with the implanted BioEdit (Thompson <italic>et al</italic>., <xref ref-type="bibr" rid="CIT0026">1994</xref>). The neighbor-joining (NJ) method in MEGA4 (Tamura <italic>et al</italic>., <xref ref-type="bibr" rid="CIT0025">2007</xref>) was used to construct the phylogenetic tree. Bootstrapping with 1,000 replicates was used to establish the confidence limits of the tree branches. Default program parameters were used. Bootstrap values from the neighbor-joining analyses were listed to the left of each node, and values higher than 50 were shown.
</p>
				<table-wrap id="T0001">
					<label>Table 1</label>
					<caption>
						<p>The GPAT enzymes used for the phylogenetic analyses</p>
					</caption>
					<table frame="hsides" rules="groups">
						<thead>
							<tr>
								<th align="left">Kingdom</th>
								<th align="left">Specie</th>
								<th align="left">Taxa terminologies</th>
								<th align="center">Gene symbol</th>
								<th align="center">Database</th>
								<th align="center">Access</th>
								<th align="center">Length (aa)</th>
							</tr>
						</thead>
						<tbody>
							<tr>
								<td align="left">Viridiplantae</td>
								<td align="left">
									<italic>Arabidopsis thaliana</italic>
								</td>
								<td align="left">At</td>
								<td align="center">ATS1</td>
								<td align="center">JGI</td>
								<td align="center">AT1G32200.2</td>
								<td align="center">459</td>
							</tr>
							<tr>
								<td align="left"/>
								<td align="left"/>
								<td align="left"/>
								<td align="center">GPAT1</td>
								<td align="center">JGI</td>
								<td align="center">AT1G06520.1</td>
								<td align="center">585</td>
							</tr>
							<tr>
								<td align="left"/>
								<td align="left"/>
								<td align="left"/>
								<td align="center">GPAT2</td>
								<td align="center">JGI</td>
								<td align="center">AT1G02390.1</td>
								<td align="center">530</td>
							</tr>
							<tr>
								<td align="left"/>
								<td align="left"/>
								<td align="left"/>
								<td align="center">GPAT3</td>
								<td align="center">JGI</td>
								<td align="center">AT4G01950.1</td>
								<td align="center">520</td>
							</tr>
							<tr>
								<td align="left"/>
								<td align="left"/>
								<td align="left"/>
								<td align="center">GPAT4</td>
								<td align="center">JGI</td>
								<td align="center">AT1G01610.1</td>
								<td align="center">503</td>
							</tr>
							<tr>
								<td align="left"/>
								<td align="left"/>
								<td align="left"/>
								<td align="center">GPAT5</td>
								<td align="center">JGI</td>
								<td align="center">AT3G11430.1</td>
								<td align="center">502</td>
							</tr>
							<tr>
								<td align="left"/>
								<td align="left"/>
								<td align="left"/>
								<td align="center">GPAT6</td>
								<td align="center">JGI</td>
								<td align="center">AT2G38110.1</td>
								<td align="center">501</td>
							</tr>
							<tr>
								<td align="left"/>
								<td align="left"/>
								<td align="left"/>
								<td align="center">GPAT7</td>
								<td align="center">JGI</td>
								<td align="center">AT5G06090.1</td>
								<td align="center">500</td>
							</tr>
							<tr>
								<td align="left"/>
								<td align="left"/>
								<td align="left"/>
								<td align="center">GPAT8</td>
								<td align="center">JGI</td>
								<td align="center">AT4G00400.1</td>
								<td align="center">500</td>
							</tr>
							<tr>
								<td align="left"/>
								<td align="left"/>
								<td align="left"/>
								<td align="center">GPAT9</td>
								<td align="center">JGI</td>
								<td align="center">AT5G60620.1</td>
								<td align="center">376</td>
							</tr>
							<tr>
								<td align="left"/>
								<td align="left">
									<italic>Glycine max</italic>
								</td>
								<td align="left">Glyma</td>
								<td align="center">ATS1</td>
								<td align="center">JGI</td>
								<td align="center">Glyma01g01800.1</td>
								<td align="center">253</td>
							</tr>
							<tr>
								<td align="left"/>
								<td align="left"/>
								<td align="left"/>
								<td align="center">ATS1</td>
								<td align="center">JGI</td>
								<td align="center">Glyma09g34110.1</td>
								<td align="center">470</td>
							</tr>
							<tr>
								<td align="left"/>
								<td align="left"/>
								<td align="left"/>
								<td align="center">GPAT1</td>
								<td align="center">JGI</td>
								<td align="center">Glyma02g45600.1</td>
								<td align="center">539</td>
							</tr>
							<tr>
								<td align="left"/>
								<td align="left"/>
								<td align="left"/>
								<td align="center">GPAT1</td>
								<td align="center">JGI</td>
								<td align="center">Glyma08g42210.1</td>
								<td align="center">552</td>
							</tr>
							<tr>
								<td align="left"/>
								<td align="left"/>
								<td align="left"/>
								<td align="center">GPAT1</td>
								<td align="center">JGI</td>
								<td align="center">Glyma14g03210.1</td>
								<td align="center">540</td>
							</tr>
							<tr>
								<td align="left"/>
								<td align="left"/>
								<td align="left"/>
								<td align="center">GPAT1</td>
								<td align="center">JGI</td>
								<td align="center">Glyma18g12750.1</td>
								<td align="center">527</td>
							</tr>
							<tr>
								<td align="left"/>
								<td align="left"/>
								<td align="left"/>
								<td align="center">GPAT2</td>
								<td align="center">JGI</td>
								<td align="center">Glyma03g37970.1</td>
								<td align="center">522</td>
							</tr>
							<tr>
								<td align="left"/>
								<td align="left"/>
								<td align="left"/>
								<td align="center">GPAT2</td>
								<td align="center">JGI</td>
								<td align="center">Glyma03g37990.1</td>
								<td align="center">481</td>
							</tr>
							<tr>
								<td align="left"/>
								<td align="left"/>
								<td align="left"/>
								<td align="center">GPAT2</td>
								<td align="center">JGI</td>
								<td align="center">Glyma02g01400.1</td>
								<td align="center">555</td>
							</tr>
							<tr>
								<td align="left"/>
								<td align="left"/>
								<td align="left"/>
								<td align="center">GPAT2</td>
								<td align="center">JGI</td>
								<td align="center">Glyma10g01420.1</td>
								<td align="center">553</td>
							</tr>
							<tr>
								<td align="left"/>
								<td align="left"/>
								<td align="left"/>
								<td align="center">GPAT2</td>
								<td align="center">JGI</td>
								<td align="center">Glyma19g40590.1</td>
								<td align="center">537</td>
							</tr>
							<tr>
								<td align="left"/>
								<td align="left"/>
								<td align="left"/>
								<td align="center">GPAT3</td>
								<td align="center">JGI</td>
								<td align="center">Glyma14g33830.1</td>
								<td align="center">417</td>
							</tr>
							<tr>
								<td align="left"/>
								<td align="left"/>
								<td align="left"/>
								<td align="center">GPAT3</td>
								<td align="center">JGI</td>
								<td align="center">Glyma14g33860.1</td>
								<td align="center">534</td>
							</tr>
							<tr>
								<td align="left"/>
								<td align="left"/>
								<td align="left"/>
								<td align="center">GPAT3</td>
								<td align="center">JGI</td>
								<td align="center">Glyma13g02250.1</td>
								<td align="center">446</td>
							</tr>
							<tr>
								<td align="left"/>
								<td align="left"/>
								<td align="left"/>
								<td align="center">GPAT4</td>
								<td align="center">JGI</td>
								<td align="center">Glyma07g07580.1</td>
								<td align="center">499</td>
							</tr>
							<tr>
								<td align="left"/>
								<td align="left"/>
								<td align="left"/>
								<td align="center">GPAT4</td>
								<td align="center">JGI</td>
								<td align="center">Glyma03g01070.1</td>
								<td align="center">500</td>
							</tr>
							<tr>
								<td align="left"/>
								<td align="left"/>
								<td align="left"/>
								<td align="center">GPAT5</td>
								<td align="center">JGI</td>
								<td align="center">Glyma02g41660.1</td>
								<td align="center">467</td>
							</tr>
							<tr>
								<td align="left"/>
								<td align="left"/>
								<td align="left"/>
								<td align="center">GPAT5</td>
								<td align="center">JGI</td>
								<td align="center">Glyma14g07290.1</td>
								<td align="center">512</td>
							</tr>
							<tr>
								<td align="left"/>
								<td align="left"/>
								<td align="left"/>
								<td align="center">GPAT6</td>
								<td align="center">JGI</td>
								<td align="center">Glyma01g27900.1</td>
								<td align="center">492</td>
							</tr>
							<tr>
								<td align="left"/>
								<td align="left"/>
								<td align="left"/>
								<td align="center">GPAT6</td>
								<td align="center">JGI</td>
								<td align="center">Glyma18g42580.1</td>
								<td align="center">539</td>
							</tr>
							<tr>
								<td align="left"/>
								<td align="left"/>
								<td align="left"/>
								<td align="center">GPAT6</td>
								<td align="center">JGI</td>
								<td align="center">Glyma20g16980.1</td>
								<td align="center">501</td>
							</tr>
							<tr>
								<td align="left"/>
								<td align="left"/>
								<td align="left"/>
								<td align="center">GPAT6</td>
								<td align="center">JGI</td>
								<td align="center">Glyma10g23560.1</td>
								<td align="center">489</td>
							</tr>
							<tr>
								<td align="left"/>
								<td align="left"/>
								<td align="left"/>
								<td align="center">GPAT6</td>
								<td align="center">JGI</td>
								<td align="center">Glyma03g14180.1</td>
								<td align="center">362</td>
							</tr>
							<tr>
								<td align="left"/>
								<td align="left"/>
								<td align="left"/>
								<td align="center">GPAT6</td>
								<td align="center">JGI</td>
								<td align="center">Glyma07g17720.1</td>
								<td align="center">496</td>
							</tr>
							<tr>
								<td align="left"/>
								<td align="left"/>
								<td align="left"/>
								<td align="center">GPAT9</td>
								<td align="center">JGI</td>
								<td align="center">Glyma05g26140.1</td>
								<td align="center">238</td>
							</tr>
							<tr>
								<td align="left"/>
								<td align="left"/>
								<td align="left"/>
								<td align="center">GPAT9</td>
								<td align="center">JGI</td>
								<td align="center">Glyma08g09080.1</td>
								<td align="center">373</td>
							</tr>
							<tr>
								<td align="left"/>
								<td align="left"/>
								<td align="left"/>
								<td align="center">GPAT9</td>
								<td align="center">JGI</td>
								<td align="center">Glyma09g21150.1</td>
								<td align="center">376</td>
							</tr>
							<tr>
								<td align="left"/>
								<td align="left">
									<italic>Medicago truncatula</italic>
								</td>
								<td align="left">Medtr</td>
								<td align="center">ATS1</td>
								<td align="center">JGI</td>
								<td align="center">Medtr5g029110.1</td>
								<td align="center">457</td>
							</tr>
							<tr>
								<td align="left"/>
								<td align="left"/>
								<td align="left"/>
								<td align="center">GPAT1</td>
								<td align="center">JGI</td>
								<td align="center">Medtr5g098930.1</td>
								<td align="center">537</td>
							</tr>
							<tr>
								<td align="left"/>
								<td align="left"/>
								<td align="left"/>
								<td align="center">GPAT1</td>
								<td align="center">JGI</td>
								<td align="center">Medtr3g062190.1</td>
								<td align="center">277</td>
							</tr>
							<tr>
								<td align="left"/>
								<td align="left"/>
								<td align="left"/>
								<td align="center">GPAT2</td>
								<td align="center">JGI</td>
								<td align="center">Medtr1g106370.1</td>
								<td align="center">542</td>
							</tr>
							<tr>
								<td align="left"/>
								<td align="left"/>
								<td align="left"/>
								<td align="center">GPAT4</td>
								<td align="center">JGI</td>
								<td align="center">Medtr8g031940.1</td>
								<td align="center">505</td>
							</tr>
							<tr>
								<td align="left"/>
								<td align="left"/>
								<td align="left"/>
								<td align="center">GPAT5</td>
								<td align="center">JGI</td>
								<td align="center">Medtr5g087710.1</td>
								<td align="center">523</td>
							</tr>
							<tr>
								<td align="left"/>
								<td align="left"/>
								<td align="left"/>
								<td align="center">GPAT6</td>
								<td align="center">JGI</td>
								<td align="center">Medtr3g024620.1</td>
								<td align="center">496</td>
							</tr>
							<tr>
								<td align="left"/>
								<td align="left"/>
								<td align="left"/>
								<td align="center">GPAT6</td>
								<td align="center">JGI</td>
								<td align="center">Medtr1g059560.1</td>
								<td align="center">504</td>
							</tr>
							<tr>
								<td align="left"/>
								<td align="left"/>
								<td align="left"/>
								<td align="center">GPAT9</td>
								<td align="center">JGI</td>
								<td align="center">Medtr8g129160.1</td>
								<td align="center">371</td>
							</tr>
							<tr>
								<td align="left"/>
								<td align="left">
									<italic>Arachis hypogaea</italic>
								</td>
								<td align="left">Ah</td>
								<td align="center">ATS1</td>
								<td align="center">NCBI</td>
								<td align="center">KC762933</td>
								<td align="center">451</td>
							</tr>
							<tr>
								<td align="left"/>
								<td align="left"/>
								<td align="left"/>
								<td align="center">GPAT1</td>
								<td align="center">NCBI</td>
								<td align="center">JN032676</td>
								<td align="center">555</td>
							</tr>
							<tr>
								<td align="left"/>
								<td align="left"/>
								<td align="left"/>
								<td align="center">GPAT2</td>
								<td align="center">NCBI</td>
								<td align="center">HQ589243</td>
								<td align="center">544</td>
							</tr>
							<tr>
								<td align="left"/>
								<td align="left"/>
								<td align="left"/>
								<td align="center">GPAT6</td>
								<td align="center">NCBI</td>
								<td align="center">HQ589244</td>
								<td align="center">499</td>
							</tr>
							<tr>
								<td align="left"/>
								<td align="left"/>
								<td align="left"/>
								<td align="center">GPAT8</td>
								<td align="center">NCBI</td>
								<td align="center">JX843442</td>
								<td align="center">505</td>
							</tr>
							<tr>
								<td align="left"/>
								<td align="left"/>
								<td align="left"/>
								<td align="center">GPAT9</td>
								<td align="center">NCBI</td>
								<td align="center">JX843441</td>
								<td align="center">376</td>
							</tr>
							<tr>
								<td align="left"/>
								<td align="left">
									<italic>Physcomitrella patens</italic>
								</td>
								<td align="left">Pp</td>
								<td align="center">ATS1</td>
								<td align="center">JGI</td>
								<td align="center">Pp1s136_120V6.1</td>
								<td align="center">494</td>
							</tr>
							<tr>
								<td align="left"/>
								<td align="left"/>
								<td align="left"/>
								<td align="center">GPAT6</td>
								<td align="center">JGI</td>
								<td align="center">Pp1s9_453V6.1</td>
								<td align="center">510</td>
							</tr>
							<tr>
								<td align="left"/>
								<td align="left"/>
								<td align="left"/>
								<td align="center">GPAT6</td>
								<td align="center">JGI</td>
								<td align="center">Pp1s134_51V6.1</td>
								<td align="center">504</td>
							</tr>
							<tr>
								<td align="left"/>
								<td align="left"/>
								<td align="left"/>
								<td align="center">GPAT6</td>
								<td align="center">JGI</td>
								<td align="center">Pp1s72_49V6.1</td>
								<td align="center">516</td>
							</tr>
							<tr>
								<td align="left"/>
								<td align="left"/>
								<td align="left"/>
								<td align="center">GPAT6</td>
								<td align="center">JGI</td>
								<td align="center">Pp1s117_125V6.1</td>
								<td align="center">517</td>
							</tr>
							<tr>
								<td align="left"/>
								<td align="left"/>
								<td align="left"/>
								<td align="center">GPAT6</td>
								<td align="center">JGI</td>
								<td align="center">Pp1s42_150V6.1</td>
								<td align="center">513</td>
							</tr>
							<tr>
								<td align="left"/>
								<td align="left"/>
								<td align="left"/>
								<td align="center">GPAT6</td>
								<td align="center">JGI</td>
								<td align="center">Pp1s281_69V6.1</td>
								<td align="center">529</td>
							</tr>
							<tr>
								<td align="left"/>
								<td align="left"/>
								<td align="left"/>
								<td align="center">GPAT6</td>
								<td align="center">JGI</td>
								<td align="center">Pp1s117_135V6.1</td>
								<td align="center">538</td>
							</tr>
							<tr>
								<td align="left"/>
								<td align="left"/>
								<td align="left"/>
								<td align="center">GPAT9</td>
								<td align="center">JGI</td>
								<td align="center">Pp1s150_100V6.1</td>
								<td align="center">276</td>
							</tr>
							<tr>
								<td align="left"/>
								<td align="left"/>
								<td align="left"/>
								<td align="center">GPAT9</td>
								<td align="center">JGI</td>
								<td align="center">Pp1s138_27V6.1</td>
								<td align="center">389</td>
							</tr>
							<tr>
								<td align="left"/>
								<td align="left">
									<italic>Chlamydomonas reinhardtii</italic>
								</td>
								<td align="left">Cre</td>
								<td align="center">ATS1</td>
								<td align="center">JGI</td>
								<td align="center">Cre02g143000.t1.2</td>
								<td align="center">410</td>
							</tr>
							<tr>
								<td align="left"/>
								<td align="left"/>
								<td align="left"/>
								<td align="center">GPAT9</td>
								<td align="center">JGI</td>
								<td align="center">Creg6130.t1</td>
								<td align="center">456</td>
							</tr>
							<tr>
								<td align="left"/>
								<td align="left">
									<italic>Volvox carteri</italic>
								</td>
								<td align="left">Vocar</td>
								<td align="center">ATS1</td>
								<td align="center">JGI</td>
								<td align="center">Vocar20013783m</td>
								<td align="center">406</td>
							</tr>
							<tr>
								<td align="left"/>
								<td align="left"/>
								<td align="left"/>
								<td align="center">GPAT9</td>
								<td align="center">JGI</td>
								<td align="center">Vocar20002974m</td>
								<td align="center">435</td>
							</tr>
						</tbody>
					</table>
				</table-wrap>
			</sec>
			<sec id="S20010">
				<title>2.8. Quantitative real-time RT-PCR</title>
				<p>A quantitative Real-time RT-PCR (qRT-PCR) analysis was performed using a LightCycler 2.0 instrument system (Roche, Germany). The alpha tubulin 5 gene (<italic>AhTUA5</italic>) was taken as a reference gene (Chi <italic>et al</italic>., <xref ref-type="bibr" rid="CIT0007">2012</xref>). Seven pairs of gene-specific primers (<xref ref-type="table" rid="T0002">Table 2</xref>) were designed after analysis of the sequences of target genes. qRT-PCR reactions were performed using the SYBR Premix Ex Taq polymerase (TaKaRa, Japan) according to the manufacturer&#x0027;s instructions. Each 20-&#x03BC;L reaction comprised 2 &#x03BC;L of template, 10 &#x03BC;L of 2&#x00D7; SYBR Premix, and 0.4 &#x03BC;L (200 nM) of each primer. The reactions were subjected to an initial denaturation step of 95 &#x00B0;C&#x00B7;10 s<sup>&#x2212;1</sup>, followed by 40 cycles of 95 &#x00B0;C&#x00B7;5s<sup>&#x2212;1</sup>, 60 &#x00B0;C&#x00B7;30s<sup>&#x2212;1</sup> and 72 &#x00B0;C&#x00B7;10s<sup>&#x2212;1</sup>. A melting curve analysis was performed at the end of the PCR run over the range 60&#x2013;95 &#x00B0;C, increasing the temperature stepwise by 0.5 &#x00B0;C every 10 s. The baseline and quantification cycle (CP) were automatically determined using the Light Cycler Software. Zero template controls were included for each primer pair, and each PCR reaction was carried out in triplicate. The relative quantification method (delta-delta Cp) was used to evaluate quantitative variation (Livak and Schmittgen, <xref ref-type="bibr" rid="CIT0012">2001</xref>).
</p>
				<table-wrap id="T0002">
					<label>Table 2</label>
					<caption>
						<p>DNA sequences of oligonucleotide primers used in this study</p>
					</caption>
					<table frame="hsides" rules="groups">
						<thead>
							<tr>
								<th align="left">Name</th>
								<th align="left">Oligonucleotide sequence 5&#x2019;&#x2013;3&#x2019;</th>
							</tr>
						</thead>
						<tbody>
							<tr>
								<td align="left">Full-length cDNA sequence cloning</td>
								<td align="left"/>
							</tr>
							<tr>
								<td align="left">ATS1-F</td>
								<td align="left">ATGAACGGGTCTCTCGCTCA</td>
							</tr>
							<tr>
								<td align="left">ATS1-R</td>
								<td align="left">CTAGTTCCACGGCTGTGACAA</td>
							</tr>
							<tr>
								<td align="left">GPAT1-F</td>
								<td align="left">ATGGTGTTTCCAATGGTGCT</td>
							</tr>
							<tr>
								<td align="left">GPAT1-R</td>
								<td align="left">TCACGACAGCAAAGTTTCTC</td>
							</tr>
							<tr>
								<td align="left">GPAT2-F</td>
								<td align="left">ATGGCTAAAATGTTCAGAGCT</td>
							</tr>
							<tr>
								<td align="left">GPAT2-R</td>
								<td align="left">CTAAGATTTACCACACGCTC</td>
							</tr>
							<tr>
								<td align="left">GPAT6-F</td>
								<td align="left">ATGGTCATGGGAGCCTTTTC</td>
							</tr>
							<tr>
								<td align="left">GPAT6-R</td>
								<td align="left">TTAAGCTTTGTTCTCCTTGTTAG</td>
							</tr>
							<tr>
								<td align="left">GPAT8-F</td>
								<td align="left">ATGGCAGCGCCGAAACCGA</td>
							</tr>
							<tr>
								<td align="left">GPAT8-R</td>
								<td align="left">TCACTTCTTGGAACTGTACATGG</td>
							</tr>
							<tr>
								<td align="left">GPAT9-F</td>
								<td align="left">ATGATGAGGAAGACCAATCC</td>
							</tr>
							<tr>
								<td align="left">GPAT9-R</td>
								<td align="left">TTACTTTTCTTCCAAGCGCC</td>
							</tr>
							<tr>
								<td align="left">Real-time RT-PCR</td>
								<td align="left"/>
							</tr>
							<tr>
								<td align="left">qTUA5-F</td>
								<td align="left">CTGATGTCGCTGTGCTCTTGG</td>
							</tr>
							<tr>
								<td align="left">qTUA5-R</td>
								<td align="left">CTGTTGAGGTTGGTGTAGGTAGG</td>
							</tr>
							<tr>
								<td align="left">qATS1-F</td>
								<td align="left">TTCCGTGACTGAGCAATATACTGTG</td>
							</tr>
							<tr>
								<td align="left">qATS1-R</td>
								<td align="left">GGCTGTGACAACGAGACTTTAGG</td>
							</tr>
							<tr>
								<td align="left">qGPAT1-F</td>
								<td align="left">CCTACTTCACTGGCTTTGTCTCTG</td>
							</tr>
							<tr>
								<td align="left">qGPAT1-R</td>
								<td align="left">CATTGGGCTTGGATTGTTCACC</td>
							</tr>
							<tr>
								<td align="left">qGPAT2-F</td>
								<td align="left">GGTGTCAGAAGCAGAGAAGAGAAG</td>
							</tr>
							<tr>
								<td align="left">qGPAT2-R</td>
								<td align="left">TGGCGAGGATTAGGGCATAGG</td>
							</tr>
							<tr>
								<td align="left">qGPAT6-F</td>
								<td align="left">GCTTCCCTCTTAACCTTCCTATGG</td>
							</tr>
							<tr>
								<td align="left">qGPAT6-R</td>
								<td align="left">TCCGCTTTGCCCTTTCTTTGG</td>
							</tr>
							<tr>
								<td align="left">qGPAT8-F</td>
								<td align="left">TCACCTACTCCGTCAGCAAGC</td>
							</tr>
							<tr>
								<td align="left">qGPAT8-R</td>
								<td align="left">GCATTGAACCGCAGCAAGAAG</td>
							</tr>
							<tr>
								<td align="left">qGPAT9-F</td>
								<td align="left">AACCTAACATTGAAGATTACCT</td>
							</tr>
							<tr>
								<td align="left">qGPAT9-R</td>
								<td align="left">ATTGACTTGAAGCACCTTAA</td>
							</tr>
						</tbody>
					</table>
				</table-wrap>
			</sec>
			<sec id="S20011">
				<title>2.9. Seed lipid analysis</title>
				<p>Lipid content in seed was determined by a standard Soxhlet extraction method (Harwood, <xref ref-type="bibr" rid="CIT0011">1984</xref>). From each cultivar, 1 g sample was ground and then extracted with petroleum ether in a Soxhlet apparatus for 8 h. Petroleum ether was then volatilized in the draft. The experiment was carried out in triplicate. Lipid content was expressed as % of seed dry weight.</p>
			</sec>
		</sec>
		<sec id="S0012" sec-type="results">
			<title>3. RESULTS</title>
			<sec id="S20013">
				<title>3.1. Isolation of glycerol-3-phosphate acyltransferase genes from peanuts</title>
				<p>Six genes that likely encode glycerol-3-phosphate acyltransferase (GPAT) proteins were found using Bioedit software. They were cloned and designated as <italic>AhATS1</italic>, <italic>AhGPAT1</italic>, <italic>AhGPAT2</italic>, <italic>AhGPAT6</italic>, <italic>AhGPAT8</italic>, and <italic>AhGAPT</italic>9 according to the homologous genes identified in Arabidopsis. Among the six genes, two genes have the complete open reading frame (ORF) in the peanut cDNA library and cloned by conventional RT-PCR, whereas four genes were cloned using the rapid amplification of cDNA ends (RACE) method. The ORFs of the five genes were 1,356 bp, 1,668 bp, 1,635 bp, 1,500 bp, 1,518 bp, and 1,131bp in length, encoding 451, 555, 544, 499, 505, and 376 amino acids, respectively. The genomic sequences were 5,766 bp, 2,146 bp, 2,209 bp, 3,176 bp, 4,474bp, 4,970 bp in length, respectively (<xref ref-type="table" rid="T0003">Table 3</xref>). The sequence information of six genes was submitted to Genbank, with the Genbank identification numbers KC762933, JN032676, HQ589243, HQ589244, JX843442, and JX843441, respectively.
</p>
				<table-wrap id="T0003">
					<label>Table 3</label>
					<caption>
						<p>Glycerol-3-phosphate acyltransferase genes in peanuts</p>
					</caption>
					<table frame="hsides" rules="groups">
						<thead>
							<tr>
								<th align="left">Protein</th>
								<th align="center">Accession</th>
								<th align="center">Len (aa)</th>
								<th align="center">ORF (bp)</th>
								<th align="center">5&#x2019; upstream region (bp)</th>
								<th align="center">3&#x2019; downstream region (bp)</th>
								<th align="center">Genomic sequences (bp)</th>
								<th align="center">Molecular mass (kDa)</th>
								<th align="center">PI</th>
							</tr>
						</thead>
						<tbody>
							<tr>
								<td align="left">ATS1</td>
								<td align="center">KC762933</td>
								<td align="center">451</td>
								<td align="center">1356</td>
								<td align="center">89</td>
								<td align="center">496</td>
								<td align="center">5766</td>
								<td align="center">49.5908</td>
								<td align="center">9.14</td>
							</tr>
							<tr>
								<td align="left">GPAT1</td>
								<td align="center">JN032676</td>
								<td align="center">555</td>
								<td align="center">1668</td>
								<td align="center">78</td>
								<td align="center">137</td>
								<td align="center">2146</td>
								<td align="center">62.6046</td>
								<td align="center">9.05</td>
							</tr>
							<tr>
								<td align="left">GPAT2</td>
								<td align="center">HQ589243</td>
								<td align="center">544</td>
								<td align="center">1635</td>
								<td align="center">62</td>
								<td align="center">61</td>
								<td align="center">2209</td>
								<td align="center">61.8657</td>
								<td align="center">9.34</td>
							</tr>
							<tr>
								<td align="left">GPAT6</td>
								<td align="center">HQ589244</td>
								<td align="center">499</td>
								<td align="center">1500</td>
								<td align="center">113</td>
								<td align="center">10</td>
								<td align="center">3176</td>
								<td align="center">55.5391</td>
								<td align="center">9.19</td>
							</tr>
							<tr>
								<td align="left">GPAT8</td>
								<td align="center">JX843442</td>
								<td align="center">505</td>
								<td align="center">1518</td>
								<td align="center">96</td>
								<td align="center">316</td>
								<td align="center">4474</td>
								<td align="center">51.642</td>
								<td align="center">9.09</td>
							</tr>
							<tr>
								<td align="left">GPAT9</td>
								<td align="center">JX843441</td>
								<td align="center">376</td>
								<td align="center">1131</td>
								<td align="center">136</td>
								<td align="center">158</td>
								<td align="center">4970</td>
								<td align="center">43.5418</td>
								<td align="center">9.09</td>
							</tr>
						</tbody>
					</table>
				</table-wrap>
				<p>A search using NCBI BLAST revealed that six GPAT proteins have high sequence similarities with GPATs in Arabidopsis. AhATS1 shares 55.1% sequence similarity with <italic>AtATS1</italic>. <italic>AhGPAT1</italic> shows 55.3% sequence similarity with <italic>AtGPAT1</italic>, <italic>AhGPAT6</italic> shares 78.2% similarity with <italic>AtGPAT6</italic>. The <italic>AhGPAT2</italic> protein shares 52.8% and 52.0% sequence similarity with <italic>AtGPAT2</italic> and <italic>AtGPAT3</italic>, respectively, and <italic>AhGPAT9</italic> shows 79% similarity with <italic>AtGPAT9</italic>. The AhGPAT8 protein is most similar to AtGPAT4 (77.9%), and AtGPAT8 (78.4%), both of which have been implicated in the synthesis of cutin polymers (Li <italic>et al</italic>., <xref ref-type="bibr" rid="CIT0014">2007b</xref>).</p>
				<p>As shown in <xref ref-type="fig" rid="F0001">Figures 1</xref> and <xref ref-type="fig" rid="F0002">2</xref>, alignment of the deduced polypeptide sequences of six GPAT proteins demonstrates that they are similar in length and share several features that are characteristic of other plastidial and membrane-bound GPATs from evolutionarily diverse organisms. These features include the presence of four conserved amino acid motifs (AT-I to AT-IV) which are important for acyltransferase activity (Ma&#x00F1;as-Fern&#x00E1;ndez <italic>et al</italic>., <xref ref-type="bibr" rid="CIT0017">2010</xref>). The typical acyltransferase (AT) domain is localized within the C-terminal half of the molecule. Residues implicated in catalysis, such as histidine and aspartic acid residues in AT-I, glycine residues in AT-III, and a proline residue in AT-IV are all present in peanut GPATs, as are the arginine (AT-II) and glutamic (serine) (AT-III) residues involved in binding to the G3P substrate (Gonzalez-Bar&#x00F3; <italic>et al</italic>., <xref ref-type="bibr" rid="CIT0010">2007</xref>). In addition to the AT region, a haloacid dehalogenase (HAD)-like domain is found in the N-terminal half of <italic>AhGPAT6</italic> and <italic>AhGPAT8</italic>. This conserved domain is present in a super-family of proteins, most of which are phosphohydrolases. Close inspection of this region in <italic>AhGPAT6</italic> and <italic>AhGPAT8</italic> and their putative orthologues reveal the presence of highly conserved motifs, named HAD-I through HAD-IV (<xref ref-type="fig" rid="F0001">Figure 1</xref>), which have been described in HAD-like proteins (Burroughs <italic>et al</italic>., <xref ref-type="bibr" rid="CIT0003">2006</xref>). They include the typical DXD signature (which contains critical aspartic acid residues that act as a nucleophile during catalysis), the extremely conserved threorine and lysin residues in HAD-II and HAD-III boxes, respectively (both of which contribute to the stability of the reaction intermediates), and a GDXXXD motif in HAT-IV that contains acidic residues required for coordination to the Mg<sup>2+</sup> ion in the active site.</p>
				<fig id="F0001">
					<label>Figure 1</label>
					<caption>
						<p>Amino acid alignment of peanut plastidial ATS1 proteins and closely related proteins found in the GenBank. Residues shared by a fraction of sequences above 0.5 were shaded, identical residues in black, similar residues in grey. AT-like domains were boxed (ATI to AT-IV). Critical residues previously identified in similar proteins were marked by dots (binding site in AT domain) or triangles (catalytic residues in AT domain). GenBank accession numbers were as follows: <italic>Arachis hypogaea</italic> (AhATS1, KC762933), <italic>Arabidopsis thaliana</italic> (AtATS1, NP_174499), <italic>Glycine ma</italic>x (GmATS1, XP_003516958), <italic>Physcomitrella patens</italic> (PpATS1, XP_001771299), <italic>Medicago truncatula</italic> (MeATS1, XP_003612801), <italic>Chlamydomonas reinhardtii</italic> (CrATS1, XP_001694977), <italic>Volvox carteri</italic> (VoATS1, XP_002950506).</p>
					</caption>
					<graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="GYA201394_e093-1190142-g001.tif"/>
				</fig>
				<fig id="F0002">
					<label>Figure 2</label>
					<caption>
						<p>Amino acid alignment of peanut membrane-bound GPAT proteins and closely related proteins found in the GenBank. Residues shared by a fraction of sequences above 0.5 were shaded, identical residues in black, similar residues in grey. Putative trans membrane domains of peanut GPAT proteins were underlined. AT and HAD-like domains were boxed (ATI to AT-IV) or marked by lines (HAD-I to HAD-IV), respectively. Critical residues previously identified in similar proteins were marked by asterisks (HAD domain), dots (binding site in AT domain) or triangles (catalytic residues in AT domain). GenBank accession numbers were as follows: <italic>Arachis hypogaea</italic> (AhGPAT1, JN032676; AhGPAT2, HQ589243; AhGPAT6, HQ589244; AhGPAT8, JX843442; AhGPAT9, JX843441), <italic>Arabidopsis thaliana</italic> (AtGPAT1, NP_563768; AtGPAT2, NP_563651; AtGPAT3, NP_192104; AtGPAT4, NP_171667; AtGPAT5, NP_187750; AtGPAT6, NP_181346; AtGPAT7, NP_196227; AtGPAT8, NP_191950; AtGPAT9, NP_568925), <italic>Glycine max</italic> (GmGPAT1, XP_003545142; GmGPAT2, XP_003520759; GmGPAT3, XP_003536864; GmGPAT6, XP_003529144; GmGPAT8, XP_003520970; GmGPAT9, XP_003533946).</p>
					</caption>
					<graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="GYA201394_e093-1190142-g002.tif"/>
				</fig>
				<p>The <italic>AhATS1</italic> protein is probably located in chloroplast, as predicted using the TargetP Server and Predotar tools. The N-terminal end of <italic>AhATS1</italic> had a high proportion of hydroxylated and small, hydrophobic amino acids, which is typical of a chloroplast transit peptide. The <italic>AhGPAT1</italic> and <italic>AhGPAT2</italic> proteins also possess an extended N-terminal region that exhibits characteristics of a mitochondrial targeting peptide. All of the other GPAT proteins lack any recognizable N-terminal intracellular targeting signal motifs, but do contain putative C-terminal ER retrieval signals.</p>
			</sec>
			<sec id="S20014">
				<title>3.2. Gene structures and distribution of conserved motifs</title>
				<p>Genes in the same clade had more similar exon/intron structures than those genes in the other clades (<xref ref-type="fig" rid="F0003">Figure 3</xref>). Both ATS1 and GPAT9 clade members had twelve exons, whereas the GPAT4/8 clade members possessed four exons. All of the remaining six GPAT clade members had two exons, except for AhGPAT1, which possessed three exons.</p>
				<fig id="F0003">
					<label>Figure 3</label>
					<caption>
						<p>The conserved motifs and exon/intron structures of the peanut and Arabidopsis GPAT genes. Schematic representation of motifs identified in peanut GPAT proteins using MEME motif search tool. Each motif was represented by a number in a colored box. Length of box did not correspond to length of motif. Boxes represented the exons and lines represented introns. The sizes of exons and introns could be estimated using the scale at the bottom. The numbers above the boxes and lines indicated the splicing phases of the GPAT sequences, 0 referred to phase 0,1 to phase 1, and 2 to phase 2.</p>
					</caption>
					<graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="GYA201394_e093-1190142-g003.tif"/>
				</fig>
				<p>The MEME motif search tool was employed to identify the conserved motifs present in peanuts and <italic>Arabidopsis</italic> GPAT proteins (<xref ref-type="fig" rid="F0003">Figure 3</xref>), and 20 distinct motifs were identified. Most of the motifs belonged to the regions that represented the typical domains of acyltransferase. The motif 4 was found in all the members of the GPAT family proteins. Both of the ATS1 proteins had the motifs 4, 11, 13, and 19, whereas the GPAT9 proteins all possessed the motifs 4, 9, and 12. The conserved motifs 1&#x2013;8 and 14 were present in all of the remaining eight GPAT clade members. Both of the GPAT1 proteins had the motifs 1&#x2013;8, 10, 14, and 20, whereas another motif 17 was present in AtGPAT1. All proteins belonging to GPAT2/3 clade had the motifs 1&#x2013;8, 10, and 14, except for AtGPAT2, which had another motif 17. All GPAT4&#x2013;GPAT8 clade members possessed the motifs 1&#x2013;8, 14, and 15. The motifs 10 and 16 were present in GPAT4/6/8 proteins, whereas the motifs 17 and 18 existed in GPAT5/7 proteins.</p>
			</sec>
			<sec id="S20015">
				<title>3.3. Phylogenetic analysis</title>
				<p>To examine the relationships among different sources of GPAT genes, the neighbor-joining method was used to construct phylogenetic trees and all tree topologies were highly congruent (<xref ref-type="fig" rid="F0004">Figure 4</xref>). As shown in the phylogenetic tree, all of the GPATs fell into three distinct clades: the ATS1 clade, GPAT9 clade, and GPAT1&#x2013;GPAT8 clades.</p>
				<fig id="F0004">
					<label>Figure 4</label>
					<caption>
						<p>Neighbor-joining tree based on the deduced amino acid sequences of GPATs. Gene sequences other than Arabidopsis and peanut GPATs were shown by their nomenclatures found at <ext-link ext-link-type="uri" xlink:href="http://www.phytozome.org,">www.phytozome.org,</ext-link> with the abbreviations. Bootstrap values from neighbor-joining analyses were listed to the left of each node, with values higher than 50 shown.</p>
					</caption>
					<graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="GYA201394_e093-1190142-g004.tif"/>
				</fig>
				<p>Searches against prokaryote and non-photosynthetic eukaryotic sequences, and of the fully sequenced genomes of <italic>Chlamydomonas</italic>, <italic>Volvox</italic> and other algae do not identify any GPATs with significant similarities (BlastX E &#x003C;10<sup>&#x2212;5</sup>) to the <italic>sn</italic>-2 GPATs found in land plants (Yang <italic>et al</italic>., <xref ref-type="bibr" rid="CIT0029">2012</xref>). In contrast, plastid-localized ATS1 and GPAT9 were found in the algal genomes. Thus the <italic>sn-</italic>2 GPAT family clearly belongs to a lineage specific to land plants and evolved to provide pathways for functions not present in other organisms. The AhATS1 protein was grouped with ATS1 enzymes from higher plants and green algae, and lie apart from membrane-bound GPAT clades. AhGPAT9 clustered with GPAT9 from higher plants and green algae, apart from the subgroup comprised of GPAT1&#x2013;GPAT8 from higher plants. The <italic>sn</italic>-2 GPAT family also fell into three distinct conserved subfamilies. It was assumed that the GPAT4/6/8 clade is the most ancient and arose early during the evolution of land plants (bryophytes), which is involved in the assembly of cutin or cutin-like polymers in the first land plants (Yang <italic>et al</italic>., <xref ref-type="bibr" rid="CIT0029">2012</xref>). In contrast, the phosphatase-minus GPAT1-3 and 5/7 clades diverged later with the appearance of tracheophytes (Yang <italic>et al</italic>., <xref ref-type="bibr" rid="CIT0029">2012</xref>). Whereas AhGPAT8 was grouped with GPAT4 and GPAT8 from higher plants, AhGPAT6 fell into the GPAT6 subfamily. Sequences of the GPAT1&#x2013;GPAT3 clade were more divergent compared with the GPAT4/6/8 and GPAT5/7 clades. AhGPAT1 and AhGPAT2 were grouped with their respective GPAT1 or GPAT2/3 enzymes from higher plants, and lie apart from the GPAT4&#x2013;GPAT8 clades.</p>
			</sec>
			<sec id="S20016">
				<title>3.4. Tissue-specific expression patterns</title>
				<p>Quantitative real-time RT-PCR (qRT-PCR) was employed to confirm the expression patterns of the six novel genes in different peanut tissues and at different stages of seed development. The alpha tubulin 5 (<italic>AhTUA5</italic>) gene was used as an internal reference control for total RNA input (Chi <italic>et al</italic>., <xref ref-type="bibr" rid="CIT0007">2012</xref>). As shown in <xref ref-type="fig" rid="F0005">Figure 5</xref>, these six genes displayed specific temporal and spatial expression patterns across different tissues and developmental stages. <italic>AhATS1</italic> showed higher transcript abundance in flowers and leaves than in any of the other tissues tested. The highest abundance of <italic>AhGPAT1</italic> transcript was in leaves and the lowest was in stems and flowers. Levels of <italic>AhGPAT2</italic> transcript were highest in leaves, followed by stems and seeds, with the lowest levels in roots and flowers. <italic>AhGPAT6</italic> and <italic>AhGPAT8</italic> had similar expression patterns, showing higher transcript abundance in leaves and roots. <italic>AhGPAT9</italic> exhibited its highest transcript accumulation in stems followed by flowers and seeds.</p>
				<fig id="F0005">
					<label>Figure 5</label>
					<caption>
						<p>Expression analysis of six <italic>AhGPAT</italic> genes using qRT-PCR in five peanut tissues and at six stages of seed development. R, root; SM, stem; L, leaf; F, flower; SD, seed. The relative mRNA abundance was normalized with respect to the peanut <italic>AhTUA5</italic> gene. The bars were standard deviations (SD) of three technical repetitions.</p>
					</caption>
					<graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="GYA201394_e093-1190142-g005.tif"/>
				</fig>
				<p>The expression patterns of six <italic>GPAT</italic> genes across six developmental stages of seeds are also shown in <xref ref-type="fig" rid="F0005">Figure 5</xref>. Levels of <italic>AhGPAT1</italic> transcript were maximal at 10 days after pegging (DAP) and decreased gradually thereafter. The expression patterns of <italic>AhGPAT2</italic> and <italic>AhGPAT6</italic> were similar over the course of seed development, with higher levels of <italic>AhGPAT2</italic> and <italic>AhGPAT8</italic> transcripts seen at 10 DAP and 40 DAP. The expression levels of <italic>AhATS1</italic> and <italic>AhGPAT6</italic> were highest at the initial stage of seed development but dramatically decreased in abundance during later stages. The <italic>AhGPAT9</italic> transcript remained relatively low at the initial stage of seed development but increased gradually during later stages of seed development. In peanut cultivar Huayu19, seed lipid content was low in the first period of lipid accumulation, but was characterized by a drastic increase during the initial four stages after pegging (<xref ref-type="fig" rid="F0005">Figure 5</xref>). The seed lipid content reached a maximum value of 49.75% at 50 DAP and decreased thereafter at 60 DAP. The expressions of the <italic>AhGPAT9</italic> gene coincided with the lipid accumulation rate in peanut seed, whereas the expressions of other <italic>AhGPAT</italic> genes were not in complete agreement with seed lipid accumulation rate, especially in the earlier stages of seed development like the period from 10 to 30 DAP. These results indicated that <italic>AhGPAT9</italic> may be an important component in the lipid biosynthesis process.</p>
			</sec>
			<sec id="S20017">
				<title>3.5. Expression patterns of AhGPATs in peanut under abiotic stress</title>
				<p>To confirm the expression patterns of six <italic>GPAT</italic> genes under cold, salt, drought and ABA stress, we monitored the changes in these transcripts in peanut leaves and roots. <xref ref-type="fig" rid="F0006">Figure 6</xref> shows the expression patterns of six <italic>GPAT</italic> genes in peanut leaves upon cold treatment. Transcript levels of <italic>AhGPAT1</italic> in the leaves decreased distinctly and rapidly between 1 h and 6 h after cold treatment, and increased thereafter. The levels of <italic>AhGPAT2</italic> transcript gradually accumulated between 1 h and 24 h after cold treatment, and then decreased drastically, with a peak level of about 4-fold increase at 24 h. The expressions of <italic>AhGPAT6</italic> and <italic>AhGPAT8</italic> were slightly increased under cold stress, with a peak level at 1 h, and then decreased gradually. The expression of <italic>AhATS1</italic> and <italic>AhGPAT9</italic> gradually decreased under cold stress, while the lowest level was detected at 72 h.</p>
				<fig id="F0006">
					<label>Figure 6</label>
					<caption>
						<p>Expression analysis of six <italic>AhGPAT</italic> genes using qRT-PCR under cold and salt stress. The relative mRNA abundance was normalized with respect to the peanut <italic>AhTUA5</italic> gene. The bars were standard deviations (SD) of three technical repetitions. CL (0 h to 72 h), leaves exposed to cold (4 &#x00B0;C) treatment; SL (0 h to 48 h), leaves exposed to high salt (200 mM NaCl) treatment; SR (0 h to 72 h), roots exposed to high salt (200 mM NaCl) treatment.</p>
					</caption>
					<graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="GYA201394_e093-1190142-g006.tif"/>
				</fig>
				<p>The expression patterns of <italic>AhGPATs</italic> in peanut leaves and roots after treatment with 200 mM NaCl were also monitored (<xref ref-type="fig" rid="F0006">Figure 6</xref>). The expression patterns of <italic>AhGPAT1</italic>, <italic>AhGPAT9</italic> and <italic>AhATS1</italic> were different in leaves and roots. Transcript levels of <italic>AhGPAT1</italic> decreased distinctly and rapidly from 1 h to 48 h in the leaves of seedlings subjected to salt treatment, but increased obviously in roots after 12 h treatment, with a nearly 4-fold increase 48 h after the salt treatment. The levels of <italic>AhGPAT9</italic> transcript decreased gradually in leaves under salt stress, but increased obviously after 24 h treatment and exhibited nearly a 7-fold increase after the roots were treated for 48 h. The transcript levels of <italic>AhATS1</italic> decreased distinctly and rapidly from 1 h to 48 h in salt-treated leaves, but increased obviously in roots after 1 h treatment, with a peak level of about 20-fold observed at 3 h. The expressions of <italic>AhGPAT2</italic> were increased under salt stress, with a peak level at 3 h in both leaves and roots, where the greatest increases were about 3-fold and 41-fold, respectively. In leaves, the expressions of <italic>AhGPAT6</italic> and <italic>AhGPAT8</italic> decreased rapidly after 1h treatment and then increased to the peak level at 3 h. After 3 h, the levels of <italic>AhGPAT6</italic> and <italic>AhGPAT8</italic> transcripts decreased distinctly. In the roots, the expressions of <italic>AhGPAT6</italic> and <italic>AhGPAT8</italic> gradually increased under salt stress, with a maximum increase of about 4-fold observed at 3 h, and then decreased substantially.</p>
				<p>A 20% solution of PEG-6000 was used to mimic drought stress to monitor the expression patterns of <italic>AhGPATs</italic> in peanut leaves and roots (<xref ref-type="fig" rid="F0007">Figure 7</xref>). In the leaves, the expressions of <italic>AhGPAT1</italic> slightly increased 3 h after treatment, and then decreased from 6 h to 72 h. In PEG-treated roots, the levels of <italic>AhGPAT1</italic> transcript were distinctly enhanced relative to the peak level (an approximately 9-fold increase) which was observed at 12 h. The transcript levels of <italic>AhGPAT2</italic> were obviously increased in both leaves and roots under drought stress, with peak expression levels at 1 h in leaves and 24 h in roots. The greatest increase was about 16-fold in leaves and 5,537-fold in roots. Within 6 h after treatment, <italic>AhGPAT6</italic> and <italic>AhGPAT8</italic> genes were slightly down-regulated in leaves and obviously up-regulated in the roots of peanut seedlings subjected to drought stress. The expressions of <italic>AhGPAT9</italic> in leaves increased rapidly with a peak level of about 6-fold increase at 3 h under drought treatment, whereas in roots the expressions increased slightly after 6 h treatment and then decreased from 6 h to 72 h. The expressions of <italic>AhATS1</italic> were obviously increased in both leaves and roots under drought stress, with peak levels for both at 3 h. The greatest increase was about 3-fold in leaves and 12-fold in roots.</p>
				<fig id="F0007">
					<label>Figure 7</label>
					<caption>
						<p>Expression analysis of six <italic>AhGPAT</italic> genes using qRT-PCR under drought and ABA stress, The relative mRNA abundance was normalized with respect to the peanut <italic>AhTUA5</italic> gene. The bars were standard deviations (SD) of three technical repetitions. DL (0 h to 72 h), leaves exposed to 20% PEG-6000 treatment; DR (0 h to 72 h), roots exposed to 20% PEG-6000 treatment, AL (0 h to 72 h), leaves exposed to 100 uM ABA treatment; AR (0 h to 72 h), roots exposed to 100 uM ABA treatment.</p>
					</caption>
					<graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="GYA201394_e093-1190142-g007.tif"/>
				</fig>
				<p>We also examined the response of <italic>AhGPAT</italic> genes to exogenously applied ABA, which is a plant signaling molecule involved in plant defense signaling pathways (<xref ref-type="fig" rid="F0007">Figure 7</xref>). There was no obvious change in the levels of <italic>AhGPAT1</italic> transcript in peanut leaves following ABA treatment, although the levels of <italic>AhGPAT1</italic> transcript in roots were obviously higher 48 h after initial exposure to exogenous ABA. In leaves, the expressions of <italic>AhGPAT2</italic> increased slightly after 1 h treatment with ABA and then decreased from 3 to 12 h. After 24 h, the levels of <italic>AhGPAT2</italic> transcript remained slightly higher than in untreated leaves. The Levels of <italic>AhGPAT2</italic> transcript were higher in ABA-treated roots than in untreated roots observed 6 h after treatment, with a maximum increase of approximately 40-fold. There were no obvious changes in the abundances of <italic>AhGPAT6</italic>, <italic>AhGPAT8</italic> and <italic>AhATS1</italic> transcripts in peanut leaves after ABA treatment. However, the levels of three transcripts increased in roots, where they reached maximum levels 6 h after ABA treatment, with the greatest increases observed being about 6-, 5- and 25-fold, respectively. The expressions of <italic>AhGPAT9</italic> were slightly increased in both the leaves and roots of seedlings subjected to ABA stress, with peak levels at 48 and 72 h, respectively.</p>
				<p>The above results indicate that <italic>GPAT</italic> transcripts from peanuts are differentially expressed following exposure to abiotic stresses or abscisic acid. The levels of <italic>AhGPAT2</italic> transcript were distinctly enhanced after exposure to all four kinds of stress treatments except for ABA-treated leaves. The transcripts of <italic>AhGPAT1</italic>, <italic>AhGPAT6</italic>, <italic>AhGPAT8</italic> and <italic>AhATS1</italic> increased substantially in roots exposed to salt, drought, and ABA stress. The expressions of <italic>AhGPAT6</italic>, <italic>AhGPAT8</italic>, <italic>AhGPAT</italic>9 and <italic>AhATS1</italic> were slightly higher in leaves under certain stress conditions than under normal conditions. These results suggest that these genes may play an important role in enhancing peanut resistance to abiotic stress. Some genes were obviously down-regulated after stress treatments, such as <italic>AhGPAT1</italic> and <italic>AhGPAT9</italic> transcripts in cold- and salt-stressed leaves. This indicates that these genes may have a negative function in peanut abiotic stress regulation.</p>
			</sec>
		</sec>
		<sec id="S0018" sec-type="discussion">
			<title>4. DISCUSSION</title>
			<p>
				<italic>sn</italic>-Glycerol-3-phosphate acyltransferase (GPAT) is an important enzyme in glycerolipid synthesis, and is involved in different metabolic pathways and physiological functions. In this study, six genes were identified. These genes likely represent the peanut homologues of Arabidopsis genes involved in the synthesis of cutin, suberin, membrane lipids, or storage lipids. Phylogenetic analysis showed that <italic>AhATS1</italic> fell into the plastidial ATS1 subgroup and showed a high sequence similarity with <italic>AtATS1</italic>. <italic>AhGPAT1</italic> and <italic>AhGPAT2</italic> belonged to the GPAT1&#x2013;3 subfamily and shared high sequence similarities with <italic>AtGPAT1</italic> and <italic>AtGPAT2/3</italic>, respectively. Sequence analysis indicates that the NH<sub>2</sub>-terminal domain of the three genes contains four acyltransferase motifs (Pfam 01553) that are conserved among glycerolipid acyltransferase family members, which include GPATs, AGPATs, and a dihydroxyacetone-phosphate acyltransferase (Takeuchi and Reue, <xref ref-type="bibr" rid="CIT0024">2009</xref>). It has been suggested that motifs I and IV are important for catalysis, and that motifs II and III are important for substrate binding. The COOH-terminal domain is also necessary for enzyme activity and appears to physically interact with the NH<sub>2</sub>-terminal domain to contribute to either catalysis or substrate binding (Pellon-Maison <italic>et al</italic>., <xref ref-type="bibr" rid="CIT0021">2006</xref>).</p>
			<p>The <italic>AhGPAT6</italic> and <italic>AhGPAT8</italic> proteins belonged to the <italic>GPAT4/6/8</italic> clades and shared high sequence similarity with <italic>AtGPAT4/8</italic> and <italic>AtGPAT6</italic>, respectively. Sequence analysis reveals that <italic>AhGPAT6</italic> and <italic>AhGPAT8</italic> each contain an N-terminal HAD-like domain attached to the acyltransferase moiety. The HAD domain is widespread over the three super-kingdoms and is found in a very diverse range of enzymes with hydrolytic activities. Maximum homology of the HAD domain from GPATs out of plants is seen for members of the &#x201C;PSP/P5N-1 assemblage&#x201D; (Burroughs <italic>et al</italic>., <xref ref-type="bibr" rid="CIT0003">2006</xref>), which are characterized by the presence of a C1-type cap module with a four-helix arrangement. This group includes enzymes with activities as diverse as those of phosphoserine phosphatases (PSP family) and nucleotidases (P5N-1 family). The presence of this typical hydrolytic domain in plant GPATs allows them to behave as bifunctional enzymes that catalyze the dephosphorylation of glycerol in addition to acyl transfer, thus yielding MAGs as the reaction product (Ma&#x00F1;as-Fern&#x00E1;ndez <italic>et al</italic>., <xref ref-type="bibr" rid="CIT0017">2010</xref>).</p>
			<p>The <italic>AhGPAT9</italic> protein showed high sequence similarity to <italic>AtGPAT9</italic>, which was identified in Arabidopsis by a bioinformatics approach, and exhibits a much closer evolutionary relationship with mammalian GPATs. Although the enzymatic activity of <italic>AtGPAT9</italic> has not been directly confirmed and its physiological function is unknown, polypeptide sequence alignment, phylogenetic analysis, conserved domain analysis and gene expression data have all suggested that AtGPAT9 may play an essential role in the synthesis of membrane and storage lipids in plants (Gidda <italic>et al</italic>., <xref ref-type="bibr" rid="CIT0009">2009</xref>; Chen <italic>et al</italic>., <xref ref-type="bibr" rid="CIT0006">2011b</xref>). Expression profiling revealed that the levels and tissue-specific accumulations of <italic>AhGPAT9</italic> transcript are distinct from those of other <italic>GPAT</italic> family members, which is consistent with the more diverged nature of the <italic>AtGPAT9</italic> gene. Notably, the expression patterns of <italic>AhGPAT9</italic> coincided with the lipid accumulation rate in peanut seed. This suggests a potential role for <italic>AhGPAT9</italic> in glycerolipid metabolism in developing seeds, although this possibility remains to be tested experimentally.</p>
			<p>Cutin and suberin are extracellular lipid barriers deposited by certain types of plant cells (Yang <italic>et al</italic>., <xref ref-type="bibr" rid="CIT0029">2012</xref>). They are both fatty acid&#x2013;and glycerol-based extracellular polymers that are insoluble in water and organic solvents (Beisson <italic>et al</italic>., <xref ref-type="bibr" rid="CIT0002">2007</xref>). These insoluble polymers and other associated waxes function to control water, gas, and ion fluxes and serve as physical barriers to protect plants from pathogen invasion (Schreiber, <xref ref-type="bibr" rid="CIT0022">2010</xref>). The seed coats of Arabidopsis <italic>gpat5</italic> mutants were substantially more permeable to tetrazolium salts than those of wild-type seeds. Furthermore, the germination rate of <italic>gpat5</italic> seeds under high salt was reduced, and <italic>gpat5</italic> seedlings were less tolerant of salt stress than wild-type seedlings (Beisson <italic>et al</italic>., <xref ref-type="bibr" rid="CIT0002">2007</xref>). The lines of <italic>B</italic>. <italic>napus</italic> in which <italic>GPAT4</italic> expression was suppressed using RNAi exhibited alterations in cuticle load and stomatal structure, resulting in increased water loss (Chen <italic>et al</italic>., <xref ref-type="bibr" rid="CIT0006">2011b</xref>). Our results indicated that <italic>AhGPAT2</italic> was distinctly enhanced under all four kinds of stress treatments except for ABA-treated leaves. The levels of <italic>AhGPAT1</italic> transcript and cutin-associated <italic>AhGPAT6</italic> and <italic>AhGPAT8</italic> transcripts increased substantially in the roots of seedlings subjected to salt, drought, and ABA stresses. Thus, we infer that these <italic>GPAT</italic> genes may be involved in regulating some kinds of abiotic stress in peanuts.</p>
			<p>GPAT family proteins play crucial roles in the synthesis of cutin, suberin, membrane lipids, and storage lipids (Chen <italic>et al</italic>., <xref ref-type="bibr" rid="CIT0005">2011a</xref>). Better the understanding of this enzyme family will be valuable to efforts to modify the content and composition of seed oils or to improve abiotic stress resistance in plants. The information generated in our study has improved our understanding of the involvement of these genes in lipid synthesis and opens the way to selecting candidate genes for functional validation studies in peanuts.</p>
		</sec>
	</body>
	<back>
		<ack>
			<title>ACKNOWLEDGMENTS</title>
			<p>This study was supported by grants from the China Agriculture Research System (CARS-14), the National Natural Science Foundation of China (31000728; 31100205; 31200211), the Natural Science Fund of Shangdong Province (ZR2009DQ004; ZR2011CQ036; ZR2014YL012), the Promotive Research Fund for Young and Middle-aged Scientisits of Shandong Province (BS2010NY023), Qingdao Municipal Science and Technology Plan Project (11-2-4-9-(3)-jch; 11-2-3-26-nsh; 12-1-4-11-(2)-jch), the Fund of the Key Laboratory of Biology and Genetic Improvement of Oil Crops, Ministry of Agriculture (2014010).</p>
		</ack>
		<ref-list>
			<title>REFERENCES</title>
			<ref id="CIT0001">
				<nlm-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Ariizumi</surname>
							<given-names>T</given-names>
						</name>
						<name>
							<surname>Kishitani</surname>
							<given-names>S</given-names>
						</name>
						<name>
							<surname>Inatsugi</surname>
							<given-names>R.</given-names>
						</name>
					</person-group>
					<article-title>An increase in unsaturation of fatty acids in phosphatidylglycerol from leaves improves the rates of photosynthesis and growth at low temperatures in transgenic rice seedlings</article-title>
					<source>Plant. Cell. Physiol.</source>
					<year>2002</year>
					<volume>43</volume>
					<fpage>751</fpage>
					<lpage>758</lpage>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="http://dx.doi.org/10.1093/pcp/pcf087">http://dx.doi.org/10.1093/pcp/pcf087</ext-link>.</comment>
				</nlm-citation>
			</ref>
			<ref id="CIT0002">
				<nlm-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Beisson</surname>
							<given-names>F</given-names>
						</name>
						<name>
							<surname>Li</surname>
							<given-names>Y</given-names>
						</name>
						<name>
							<surname>Bonaventure</surname>
							<given-names>G</given-names>
						</name>
						<name>
							<surname>Pollard</surname>
							<given-names>M</given-names>
						</name>
						<name>
							<surname>Ohlrogge</surname>
							<given-names>JB.</given-names>
						</name>
					</person-group>
					<article-title>The acyltransferase GPAT5 is required for the synthesis of suberin in seed coat and root of <italic>Arabidopsis. Plant</italic>
					</article-title>
					<source>Cell.</source>
					<year>2007</year>
					<volume>19</volume>
					<fpage>351</fpage>
					<lpage>368</lpage>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="http://dx.doi.org/10.1105/tpc.106.048033">http://dx.doi.org/10.1105/tpc.106.048033</ext-link>.</comment>
				</nlm-citation>
			</ref>
			<ref id="CIT0003">
				<nlm-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Burroughs</surname>
							<given-names>AM</given-names>
						</name>
						<name>
							<surname>Allen</surname>
							<given-names>KN</given-names>
						</name>
						<name>
							<surname>Dunaway-Mariano</surname>
							<given-names>D</given-names>
						</name>
						<name>
							<surname>Aravind</surname>
							<given-names>L.</given-names>
						</name>
					</person-group>
					<article-title>Evolutionary genomics of the HAD superfamily: understanding the structural adaptations and catalytic diversity in a superfamily of phosphoesterases and allied enzymes</article-title>
					<source>J. Mol. Biol.</source>
					<year>2006</year>
					<volume>361</volume>
					<fpage>1003</fpage>
					<lpage>1034</lpage>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="http://dx.doi.org/10.1016/j.jmb.2006.06.049">http://dx.doi.org/10.1016/j.jmb.2006.06.049</ext-link>.
					</comment>
				</nlm-citation>
			</ref>
			<ref id="CIT0004">
				<nlm-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Cao</surname>
							<given-names>J</given-names>
						</name>
						<name>
							<surname>Li</surname>
							<given-names>JL</given-names>
						</name>
						<name>
							<surname>Li</surname>
							<given-names>D</given-names>
						</name>
						<name>
							<surname>Tobin</surname>
							<given-names>JF</given-names>
						</name>
						<name>
							<surname>Gimeno</surname>
							<given-names>RE.</given-names>
						</name>
					</person-group>
					<article-title>Molecular identification of microsomal acyl-CoA: glycerol-3-phosphate acyltransferase, a key enzyme in de novo triacylglycerol synthesis</article-title>
					<source>Proc. Natl. Acad. Sci. USA.</source>
					<year>2006</year>
					<volume>103</volume>
					<fpage>19695</fpage>
					<lpage>19700</lpage>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="http://dx.doi.org/10.1073/pnas.0609140103">http://dx.doi.org/10.1073/pnas.0609140103</ext-link>.</comment>
				</nlm-citation>
			</ref>
			<ref id="CIT0005">
				<nlm-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Chen</surname>
							<given-names>X</given-names>
						</name>
						<name>
							<surname>Snyder</surname>
							<given-names>CL</given-names>
						</name>
						<name>
							<surname>Truksa</surname>
							<given-names>M</given-names>
						</name>
						<name>
							<surname>Shah</surname>
							<given-names>S</given-names>
						</name>
						<name>
							<surname>Weselake</surname>
							<given-names>RJ.</given-names>
						</name>
					</person-group>
					<article-title>sn-Glycerol-3-phosphate acyltransferases in plants</article-title>
					<source>Plant Signaling Behavior.</source>
					<year>2011a</year>
					<volume>6</volume>
					<fpage>1695</fpage>
					<lpage>1699</lpage>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="http://dx.doi.org/10.4161/psb.6.11.17777">http://dx.doi.org/10.4161/psb.6.11.17777</ext-link>.</comment>
				</nlm-citation>
			</ref>
			<ref id="CIT0006">
				<nlm-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Chen</surname>
							<given-names>X</given-names>
						</name>
						<name>
							<surname>Truksa</surname>
							<given-names>M</given-names>
						</name>
						<name>
							<surname>Snyder</surname>
							<given-names>CL</given-names>
						</name>
						<name>
							<surname>El-Mezawy</surname>
							<given-names>A</given-names>
						</name>
						<name>
							<surname>Shah</surname>
							<given-names>S</given-names>
						</name>
						<name>
							<surname>Weselake</surname>
							<given-names>RJ.</given-names>
						</name>
					</person-group>
					<article-title>Three Homologous genes encoding sn-glycerol-3-phosphate acyltransferase 4 exhibit different expression patterns and functional divergence in <italic>Brassica napus</italic>
					</article-title>
					<source>Plant Physiol.</source>
					<year>2011b</year>
					<volume>155</volume>
					<fpage>851</fpage>
					<lpage>865</lpage>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="http://dx.doi.org/10.1104/pp.110.169482">http://dx.doi.org/10.1104/pp.110.169482</ext-link>.</comment>
				</nlm-citation>
			</ref>
			<ref id="CIT0007">
				<nlm-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Chi</surname>
							<given-names>XY</given-names>
						</name>
						<name>
							<surname>Hu</surname>
							<given-names>RB</given-names>
						</name>
						<name>
							<surname>Yang</surname>
							<given-names>QL</given-names>
						</name>
						<name>
							<surname>Zhang</surname>
							<given-names>XW</given-names>
						</name>
						<name>
							<surname>Pan</surname>
							<given-names>LJ</given-names>
						</name>
						<name>
							<surname>Chen</surname>
							<given-names>N</given-names>
						</name>
						<name>
							<surname>Chen</surname>
							<given-names>MN</given-names>
						</name>
						<name>
							<surname>Yang</surname>
							<given-names>Z</given-names>
						</name>
						<name>
							<surname>Wang</surname>
							<given-names>T</given-names>
						</name>
						<name>
							<surname>He</surname>
							<given-names>YN</given-names>
						</name>
						<name>
							<surname>Yu</surname>
							<given-names>SL.</given-names>
						</name>
					</person-group>
					<article-title>Validation of reference genes for gene expression studies in peanut by quantitative real-time RT-PCR</article-title>
					<source>Mol. Genet. Genomics.</source>
					<year>2012</year>
					<volume>287</volume>
					<fpage>167</fpage>
					<lpage>176</lpage>
				</nlm-citation>
			</ref>
			<ref id="CIT0008">
				<nlm-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Chi</surname>
							<given-names>XY</given-names>
						</name>
						<name>
							<surname>Yang</surname>
							<given-names>QL</given-names>
						</name>
						<name>
							<surname>Pan</surname>
							<given-names>LJ</given-names>
						</name>
						<name>
							<surname>Chen</surname>
							<given-names>MN</given-names>
						</name>
						<name>
							<surname>He</surname>
							<given-names>YN</given-names>
						</name>
						<name>
							<surname>Yang</surname>
							<given-names>Z</given-names>
						</name>
						<name>
							<surname>Yu</surname>
							<given-names>SL.</given-names>
						</name>
					</person-group>
					<article-title>Isolation and characterization of fatty acid desaturase genes from peanut (<italic>Arachis hypogaea</italic> L.)</article-title>
					<source>Plant. Cell. Rep.</source>
					<year>2011</year>
					<volume>30</volume>
					<fpage>1393</fpage>
					<lpage>1404</lpage>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="http://dx.doi.org/10.1007/s00438-011-0665-5">http://dx.doi.org/10.1007/s00438-011-0665-5</ext-link>.</comment>
				</nlm-citation>
			</ref>
			<ref id="CIT0009">
				<nlm-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Gidda</surname>
							<given-names>SK</given-names>
						</name>
						<name>
							<surname>Shockey</surname>
							<given-names>JM</given-names>
						</name>
						<name>
							<surname>Rothstein</surname>
							<given-names>SJ</given-names>
						</name>
						<name>
							<surname>Dyer</surname>
							<given-names>JM</given-names>
						</name>
						<name>
							<surname>Mullen</surname>
							<given-names>RT.</given-names>
						</name>
					</person-group>
					<article-title>
						<italic>Arabidopsis thaliana</italic> GPAT8 and GPAT9 are localized to the ER and possess distinct ER retrieval signals: functional divergence of the dilysine ER retrieval motif in plant cells</article-title>
					<source>Plant. Physiol. Biochem.</source>
					<year>2009</year>
					<volume>47</volume>
					<fpage>867</fpage>
					<lpage>879</lpage>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="http://dx.doi.org/10.1016/j.plaphy.2009.05.008">http://dx.doi.org/10.1016/j.plaphy.2009.05.008</ext-link>.</comment>
				</nlm-citation>
			</ref>
			<ref id="CIT0010">
				<nlm-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Gonzalez-Bar&#x00F3;</surname>
							<given-names>MR</given-names>
						</name>
						<name>
							<surname>Lewin</surname>
							<given-names>TM</given-names>
						</name>
						<name>
							<surname>Coleman</surname>
							<given-names>RA.</given-names>
						</name>
					</person-group>
					<article-title>Regulation of Triglyceride Metabolism II. Function of mitochondrial GPAT1 in the regulation of triacylglycerol biosynthesis and insulin action</article-title>
					<source>Am. J. Physiol. Gastrointest. Liver. Physiol.</source>
					<year>2007</year>
					<volume>292</volume>
					<fpage>G1195</fpage>
					<lpage>G1199</lpage>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="http://dx.doi.org/10.1152/ajpgi.00553.2006">http://dx.doi.org/10.1152/ajpgi.00553.2006</ext-link>.</comment>
				</nlm-citation>
			</ref>
			<ref id="CIT0011">
				<nlm-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Harwood</surname>
							<given-names>H.</given-names>
						</name>
					</person-group>
					<article-title>Oleochemicals as a fuel. Mechanical and economic feasibility</article-title>
					<source>J. Am. Oil Chem. Soc.</source>
					<year>1984</year>
					<volume>61</volume>
					<fpage>315</fpage>
					<lpage>324</lpage>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="http://dx.doi.org/10.1007/BF02678788">http://dx.doi.org/10.1007/BF02678788</ext-link>.</comment>
				</nlm-citation>
			</ref>
			<ref id="CIT0012">
				<nlm-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Livak</surname>
							<given-names>KJ</given-names>
						</name>
						<name>
							<surname>Schmittgen</surname>
							<given-names>TD.</given-names>
						</name>
					</person-group>
					<article-title>Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) <italic>Method</italic>
					</article-title>
					<source>Methods.</source>
					<year>2001</year>
					<volume>25</volume>
					<fpage>402</fpage>
					<lpage>408</lpage>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="http://dx.doi.org/10.1006/meth.2001.1262">http://dx.doi.org/10.1006/meth.2001.1262</ext-link>.</comment>
				</nlm-citation>
			</ref>
			<ref id="CIT0013">
				<nlm-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Li</surname>
							<given-names>XC</given-names>
						</name>
						<name>
							<surname>Zhu</surname>
							<given-names>J</given-names>
						</name>
						<name>
							<surname>Yang</surname>
							<given-names>J</given-names>
						</name>
						<name>
							<surname>Zhang</surname>
							<given-names>GR</given-names>
						</name>
						<name>
							<surname>Xing</surname>
							<given-names>WF</given-names>
						</name>
						<name>
							<surname>Zhang</surname>
							<given-names>S</given-names>
						</name>
						<name>
							<surname>Yang</surname>
							<given-names>ZN.</given-names>
						</name>
					</person-group>
					<article-title>Glycerol-3-phosphate acyltransferase 6 (GPAT6) is important for tapetum development in <italic>Arabidopsis</italic> and plays multiple roles in plant fertility</article-title>
					<source>Molecular Plant.</source>
					<year>2011</year>
					<volume>5</volume>
					<fpage>131</fpage>
					<lpage>142</lpage>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="http://dx.doi.org/10.1093/mp/ssr057">http://dx.doi.org/10.1093/mp/ssr057</ext-link>.</comment>
				</nlm-citation>
			</ref>
			<ref id="CIT0014">
				<nlm-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Li</surname>
							<given-names>Y</given-names>
						</name>
						<name>
							<surname>Beisson</surname>
							<given-names>F</given-names>
						</name>
						<name>
							<surname>Koo</surname>
							<given-names>AJ</given-names>
						</name>
						<name>
							<surname>Molina</surname>
							<given-names>I</given-names>
						</name>
						<name>
							<surname>Pollard</surname>
							<given-names>M</given-names>
						</name>
						<name>
							<surname>Ohlrogge</surname>
							<given-names>J.</given-names>
						</name>
					</person-group>
					<article-title>Identification of acyltransferases required for cutin biosynthesis and production of cutin with suberin-like monomers</article-title>
					<source>Proc. Natl. Acad. Sci. USA.</source>
					<year>2007b</year>
					<volume>104</volume>
					<fpage>18339</fpage>
					<lpage>18344</lpage>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="http://dx.doi.org/10.1073/pnas.0706984104">http://dx.doi.org/10.1073/pnas.0706984104</ext-link>.</comment>
				</nlm-citation>
			</ref>
			<ref id="CIT0015">
				<nlm-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Li</surname>
							<given-names>Y</given-names>
						</name>
						<name>
							<surname>Beisson</surname>
							<given-names>F</given-names>
						</name>
						<name>
							<surname>Ohlrogge</surname>
							<given-names>J</given-names>
						</name>
						<name>
							<surname>Pollard</surname>
							<given-names>M.</given-names>
						</name>
					</person-group>
					<article-title>Monoacylglycerols are components of root waxes and can be produced in the aerial cuticle by ectopic expression of a suberin-associated acyltransferase</article-title>
					<source>Plant. Physiol.</source>
					<year>2007a</year>
					<volume>144</volume>
					<fpage>1267</fpage>
					<lpage>1277</lpage>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="http://dx.doi.org/10.1104/pp.107.099432">http://dx.doi.org/10.1104/pp.107.099432</ext-link>.</comment>
				</nlm-citation>
			</ref>
			<ref id="CIT0016">
				<nlm-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Li-Beisson</surname>
							<given-names>Y</given-names>
						</name>
						<name>
							<surname>Pollard</surname>
							<given-names>M</given-names>
						</name>
						<name>
							<surname>Sauveplane</surname>
							<given-names>V</given-names>
						</name>
						<name>
							<surname>Pinot</surname>
							<given-names>F</given-names>
						</name>
						<name>
							<surname>Ohlrogge</surname>
							<given-names>J</given-names>
						</name>
						<name>
							<surname>Beisson</surname>
							<given-names>F.</given-names>
						</name>
					</person-group>
					<article-title>Nanoridges that characterize the surface morphology of flowers require the synthesis of cutin polyester</article-title>
					<source>Proc. Natl. Acad. Sci. USA.</source>
					<year>2009</year>
					<volume>106</volume>
					<fpage>22008</fpage>
					<lpage>22013</lpage>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="http://dx.doi.org/10.1073/pnas.0909090106">http://dx.doi.org/10.1073/pnas.0909090106</ext-link>.</comment>
				</nlm-citation>
			</ref>
			<ref id="CIT0017">
				<nlm-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Ma&#x00F1;as-Fern&#x00E1;ndez</surname>
							<given-names>A</given-names>
						</name>
						<name>
							<surname>Li-Beisson</surname>
							<given-names>Y</given-names>
						</name>
						<name>
							<surname>Alonso</surname>
							<given-names>DL</given-names>
						</name>
						<name>
							<surname>Garc&#x00ED;a-Maroto</surname>
							<given-names>F.</given-names>
						</name>
					</person-group>
					<article-title>Cloning and molecular characterization of a glycerol-3-phosphate <italic>O</italic>-acyltransferase (GPAT) gene from <italic>Echium</italic> (Boraginaceae) involved in the biosynthesis of cutin polyesters</article-title>
					<source>Planta.</source>
					<year>2010</year>
					<volume>232</volume>
					<fpage>987</fpage>
					<lpage>997</lpage>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="http://dx.doi.org/10.1007/s00425-010-1232-8">http://dx.doi.org/10.1007/s00425-010-1232-8</ext-link>.</comment>
				</nlm-citation>
			</ref>
			<ref id="CIT0018">
				<nlm-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Murata</surname>
							<given-names>N</given-names>
						</name>
						<name>
							<surname>Ishizaki-Nishizawa</surname>
							<given-names>O</given-names>
						</name>
						<name>
							<surname>Higashi</surname>
							<given-names>S</given-names>
						</name>
						<name>
							<surname>Hayashi</surname>
							<given-names>H</given-names>
						</name>
						<name>
							<surname>Tasaka</surname>
							<given-names>Y</given-names>
						</name>
						<name>
							<surname>Nishida</surname>
							<given-names>I.</given-names>
						</name>
					</person-group>
					<article-title>Genetically engineered alteration in the chilling sensitivity of plants</article-title>
					<source>Nature.</source>
					<year>1992</year>
					<volume>365</volume>
					<fpage>710</fpage>
					<lpage>713</lpage>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="http://dx.doi.org/10.1038/356710a0">http://dx.doi.org/10.1038/356710a0</ext-link>.</comment>
				</nlm-citation>
			</ref>
			<ref id="CIT0019">
				<nlm-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Murata</surname>
							<given-names>N</given-names>
						</name>
						<name>
							<surname>Tasaka</surname>
							<given-names>Y.</given-names>
						</name>
					</person-group>
					<article-title>Glycerol-3-phosphate acyltransferase in plants</article-title>
					<source>Biochim. Biophys. Acta.</source>
					<year>1997</year>
					<volume>1348</volume>
					<issue>1&#x2013;2</issue>
					<fpage>10</fpage>
					<lpage>16</lpage>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="http://dx.doi.org/10.1016/S0005-2760(97)00115-X">http://dx.doi.org/10.1016/S0005-2760(97)00115-X</ext-link>.</comment>
				</nlm-citation>
			</ref>
			<ref id="CIT0020">
				<nlm-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Nishida</surname>
							<given-names>I</given-names>
						</name>
						<name>
							<surname>Tasaka</surname>
							<given-names>Y</given-names>
						</name>
						<name>
							<surname>Shiraishi</surname>
							<given-names>H</given-names>
						</name>
						<name>
							<surname>Murata</surname>
							<given-names>N.</given-names>
						</name>
					</person-group>
					<article-title>The gene and the RNA for the precursor to the plastid-located glycerol-3-phosphate acyltransferase of <italic>Arabidopsis thaliana</italic>
					</article-title>
					<source>Plant. Mol. Biol.</source>
					<year>1993</year>
					<volume>21</volume>
					<fpage>267</fpage>
					<lpage>277</lpage>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="http://dx.doi.org/10.1007/BF00019943">http://dx.doi.org/10.1007/BF00019943</ext-link>.</comment>
				</nlm-citation>
			</ref>
			<ref id="CIT0021">
				<nlm-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Pellon-Maison</surname>
							<given-names>M</given-names>
						</name>
						<name>
							<surname>Coleman</surname>
							<given-names>RA</given-names>
						</name>
						<name>
							<surname>Gonzalez-Bar&#x00F3;</surname>
							<given-names>MR.</given-names>
						</name>
					</person-group>
					<article-title>The C-terminal region of mitochondrial glycerol-3-phosphate acyltransferase-1 interacts with the active site region and is required for activity</article-title>
					<source>Arch. Biochem. Biophys.</source>
					<year>2006</year>
					<volume>450</volume>
					<fpage>157</fpage>
					<lpage>166</lpage>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="http://dx.doi.org/10.1016/j.abb.2006.03.009">http://dx.doi.org/10.1016/j.abb.2006.03.009</ext-link>.</comment>
				</nlm-citation>
			</ref>
			<ref id="CIT0022">
				<nlm-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Schreiber</surname>
							<given-names>L.</given-names>
						</name>
					</person-group>
					<article-title>Transport barriers made of cutin, suberin and associated waxes</article-title>
					<source>Trends. Plant. Sci.</source>
					<year>2010</year>
					<volume>15</volume>
					<fpage>546</fpage>
					<lpage>553</lpage>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="http://dx.doi.org/10.1016/j.tplants.2010.06.004">http://dx.doi.org/10.1016/j.tplants.2010.06.004</ext-link>.</comment>
				</nlm-citation>
			</ref>
			<ref id="CIT0023">
				<nlm-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Sui</surname>
							<given-names>N</given-names>
						</name>
						<name>
							<surname>Li</surname>
							<given-names>M</given-names>
						</name>
						<name>
							<surname>Zhao</surname>
							<given-names>SJ</given-names>
						</name>
						<name>
							<surname>Li</surname>
							<given-names>F</given-names>
						</name>
						<name>
							<surname>Liang</surname>
							<given-names>H</given-names>
						</name>
						<name>
							<surname>Meng</surname>
							<given-names>QW.</given-names>
						</name>
					</person-group>
					<article-title>Overexpression of glycerol-3-phosphate acyltransferase gene improves chilling tolerance in tomato</article-title>
					<source>Planta.</source>
					<year>2007</year>
					<volume>226</volume>
					<fpage>1097</fpage>
					<lpage>1108</lpage>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="http://dx.doi.org/10.1007/s00425-007-0554-7">http://dx.doi.org/10.1007/s00425-007-0554-7</ext-link>.</comment>
				</nlm-citation>
			</ref>
			<ref id="CIT0024">
				<nlm-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Takeuchi</surname>
							<given-names>K</given-names>
						</name>
						<name>
							<surname>Reue</surname>
							<given-names>K.</given-names>
						</name>
					</person-group>
					<article-title>Biochemistry, physiology, and genetics of GPAT, AGPAT, and lipin enzymes in triglyceride synthesis</article-title>
					<source>Am. J. Physiol. Endocrinol. Metab.</source>
					<year>2009</year>
					<volume>296</volume>
					<fpage>E1195</fpage>
					<lpage>E1209</lpage>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="http://dx.doi.org/10.1152/ajpendo.90958.2008">http://dx.doi.org/10.1152/ajpendo.90958.2008</ext-link>.</comment>
				</nlm-citation>
			</ref>
			<ref id="CIT0025">
				<nlm-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Tamura</surname>
							<given-names>K</given-names>
						</name>
						<name>
							<surname>Dudley</surname>
							<given-names>J</given-names>
						</name>
						<name>
							<surname>Nei</surname>
							<given-names>M</given-names>
						</name>
						<name>
							<surname>Kumar</surname>
							<given-names>S.</given-names>
						</name>
					</person-group>
					<article-title>MEGA4: Molecular evolutionary genetics analysis (MEGA) software version 4.0</article-title>
					<source>Molecular Biology and Evolution.</source>
					<year>2007</year>
					<volume>24</volume>
					<fpage>1596</fpage>
					<lpage>1599</lpage>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="http://dx.doi.org/10.1093/molbev/msm092">http://dx.doi.org/10.1093/molbev/msm092</ext-link>.</comment>
				</nlm-citation>
			</ref>
			<ref id="CIT0026">
				<nlm-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Thompson</surname>
							<given-names>JD</given-names>
						</name>
						<name>
							<surname>Higgins</surname>
							<given-names>DG</given-names>
						</name>
						<name>
							<surname>Gibson</surname>
							<given-names>TJ.</given-names>
						</name>
					</person-group>
					<article-title>CLUSTALW: Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice</article-title>
					<source>Nucleic. Acids. Res.</source>
					<year>1994</year>
					<volume>22</volume>
					<fpage>4673</fpage>
					<lpage>4680</lpage>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="http://dx.doi.org/10.1093/nar/22.22.4673">http://dx.doi.org/10.1093/nar/22.22.4673</ext-link>.</comment>
				</nlm-citation>
			</ref>
			<ref id="CIT0027">
				<nlm-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Xu</surname>
							<given-names>C</given-names>
						</name>
						<name>
							<surname>Cornish</surname>
							<given-names>AJ</given-names>
						</name>
						<name>
							<surname>Froehlich</surname>
							<given-names>JE</given-names>
						</name>
						<name>
							<surname>Benning</surname>
							<given-names>C.</given-names>
						</name>
					</person-group>
					<article-title>Phosphatidylglycerol biosynthesis in chloroplasts of Arabidopsis mutants deficient in acyl-ACP glycerol-3-phosphate acyltransferase</article-title>
					<source>Plant. J.</source>
					<year>2006</year>
					<volume>47</volume>
					<fpage>296</fpage>
					<lpage>309</lpage>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="http://dx.doi.org/10.1111/j.1365-313X.2006.02790.x">http://dx.doi.org/10.1111/j.1365-313X.2006.02790.x</ext-link>.</comment>
				</nlm-citation>
			</ref>
			<ref id="CIT0028">
				<nlm-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Yan</surname>
							<given-names>K</given-names>
						</name>
						<name>
							<surname>Chen</surname>
							<given-names>N</given-names>
						</name>
						<name>
							<surname>Qu</surname>
							<given-names>YY</given-names>
						</name>
						<name>
							<surname>Dong</surname>
							<given-names>XC</given-names>
						</name>
						<name>
							<surname>Meng</surname>
							<given-names>QW</given-names>
						</name>
						<name>
							<surname>Zhao</surname>
							<given-names>SJ.</given-names>
						</name>
					</person-group>
					<article-title>Overexpression of sweet pepper <italic>glycerol-3-phosphate acyltransferase</italic> gene enhanced thermotolerance of photo-synthetic apparatus in transgenic tobacco</article-title>
					<source>J. Integrative Plant Biol.</source>
					<year>2008</year>
					<volume>50</volume>
					<fpage>613</fpage>
					<lpage>621</lpage>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="http://dx.doi.org/10.1111/j.1744-7909.2008.00652.x">http://dx.doi.org/10.1111/j.1744-7909.2008.00652.x</ext-link>.</comment>
				</nlm-citation>
			</ref>
			<ref id="CIT0029">
				<nlm-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Yang</surname>
							<given-names>WL</given-names>
						</name>
						<name>
							<surname>Simpson</surname>
							<given-names>JP</given-names>
						</name>
						<name>
							<surname>Li-Beisson</surname>
							<given-names>YH</given-names>
						</name>
						<name>
							<surname>Beisson</surname>
							<given-names>F</given-names>
						</name>
						<name>
							<surname>Pollard</surname>
							<given-names>M</given-names>
						</name>
						<name>
							<surname>Ohlrogge</surname>
							<given-names>JB.</given-names>
						</name>
					</person-group>
					<article-title>A land-plant-specific glycerol-3-phosphate acyltransferase family in Arabidopsis: substrate specificity, sn-2 preference and evolution</article-title>
					<source>Plant Physiol.</source>
					<year>2012</year>
					<volume>160</volume>
					<fpage>638</fpage>
					<lpage>652</lpage>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="http://dx.doi.org/10.1104/pp.112.201996">http://dx.doi.org/10.1104/pp.112.201996</ext-link>.</comment>
				</nlm-citation>
			</ref>
			<ref id="CIT0030">
				<nlm-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Zheng</surname>
							<given-names>Z</given-names>
						</name>
						<name>
							<surname>Xia</surname>
							<given-names>Q</given-names>
						</name>
						<name>
							<surname>Dauk</surname>
							<given-names>M</given-names>
						</name>
						<name>
							<surname>Shen</surname>
							<given-names>W</given-names>
						</name>
						<name>
							<surname>Selvaraj</surname>
							<given-names>G</given-names>
						</name>
						<name>
							<surname>Zou</surname>
							<given-names>J.</given-names>
						</name>
					</person-group>
					<article-title>Arabidopsis <italic>AtGPAT1</italic>, a member of the membrane-bound glycerol-3-phosphate acyltransferase gene family, is essential for tapetum differentiation and male fertility</article-title>
					<source>Plant Cell.</source>
					<year>2003</year>
					<volume>15</volume>
					<fpage>1872</fpage>
					<lpage>1887</lpage>
					<comment>
						<ext-link ext-link-type="uri" xlink:href="http://dx.doi.org/10.1105/tpc.012427">http://dx.doi.org/10.1105/tpc.012427</ext-link>.</comment>
				</nlm-citation>
			</ref>
		</ref-list>
	</back>
</article>
